ID: 983630918

View in Genome Browser
Species Human (GRCh38)
Location 4:169848421-169848443
Sequence GAGAGGTTGACAGTTCTATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983630918_983630920 -2 Left 983630918 4:169848421-169848443 CCTCATAGAACTGTCAACCTCTC No data
Right 983630920 4:169848442-169848464 TCTCCTTGTTTATGTTCCTGTGG No data
983630918_983630922 0 Left 983630918 4:169848421-169848443 CCTCATAGAACTGTCAACCTCTC No data
Right 983630922 4:169848444-169848466 TCCTTGTTTATGTTCCTGTGGGG No data
983630918_983630925 25 Left 983630918 4:169848421-169848443 CCTCATAGAACTGTCAACCTCTC No data
Right 983630925 4:169848469-169848491 AACCCTGACTAGAAAAGTGCAGG No data
983630918_983630921 -1 Left 983630918 4:169848421-169848443 CCTCATAGAACTGTCAACCTCTC No data
Right 983630921 4:169848443-169848465 CTCCTTGTTTATGTTCCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983630918 Original CRISPR GAGAGGTTGACAGTTCTATG AGG (reversed) Intergenic