ID: 983630920

View in Genome Browser
Species Human (GRCh38)
Location 4:169848442-169848464
Sequence TCTCCTTGTTTATGTTCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983630916_983630920 9 Left 983630916 4:169848410-169848432 CCTTGCATGACCCTCATAGAACT No data
Right 983630920 4:169848442-169848464 TCTCCTTGTTTATGTTCCTGTGG No data
983630915_983630920 12 Left 983630915 4:169848407-169848429 CCTCCTTGCATGACCCTCATAGA No data
Right 983630920 4:169848442-169848464 TCTCCTTGTTTATGTTCCTGTGG No data
983630918_983630920 -2 Left 983630918 4:169848421-169848443 CCTCATAGAACTGTCAACCTCTC No data
Right 983630920 4:169848442-169848464 TCTCCTTGTTTATGTTCCTGTGG No data
983630917_983630920 -1 Left 983630917 4:169848420-169848442 CCCTCATAGAACTGTCAACCTCT No data
Right 983630920 4:169848442-169848464 TCTCCTTGTTTATGTTCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983630920 Original CRISPR TCTCCTTGTTTATGTTCCTG TGG Intergenic