ID: 983630922

View in Genome Browser
Species Human (GRCh38)
Location 4:169848444-169848466
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983630918_983630922 0 Left 983630918 4:169848421-169848443 CCTCATAGAACTGTCAACCTCTC No data
Right 983630922 4:169848444-169848466 TCCTTGTTTATGTTCCTGTGGGG No data
983630916_983630922 11 Left 983630916 4:169848410-169848432 CCTTGCATGACCCTCATAGAACT No data
Right 983630922 4:169848444-169848466 TCCTTGTTTATGTTCCTGTGGGG No data
983630917_983630922 1 Left 983630917 4:169848420-169848442 CCCTCATAGAACTGTCAACCTCT No data
Right 983630922 4:169848444-169848466 TCCTTGTTTATGTTCCTGTGGGG No data
983630915_983630922 14 Left 983630915 4:169848407-169848429 CCTCCTTGCATGACCCTCATAGA No data
Right 983630922 4:169848444-169848466 TCCTTGTTTATGTTCCTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type