ID: 983630925

View in Genome Browser
Species Human (GRCh38)
Location 4:169848469-169848491
Sequence AACCCTGACTAGAAAAGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983630917_983630925 26 Left 983630917 4:169848420-169848442 CCCTCATAGAACTGTCAACCTCT No data
Right 983630925 4:169848469-169848491 AACCCTGACTAGAAAAGTGCAGG No data
983630919_983630925 8 Left 983630919 4:169848438-169848460 CCTCTCTCCTTGTTTATGTTCCT No data
Right 983630925 4:169848469-169848491 AACCCTGACTAGAAAAGTGCAGG No data
983630918_983630925 25 Left 983630918 4:169848421-169848443 CCTCATAGAACTGTCAACCTCTC No data
Right 983630925 4:169848469-169848491 AACCCTGACTAGAAAAGTGCAGG No data
983630923_983630925 1 Left 983630923 4:169848445-169848467 CCTTGTTTATGTTCCTGTGGGGT No data
Right 983630925 4:169848469-169848491 AACCCTGACTAGAAAAGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983630925 Original CRISPR AACCCTGACTAGAAAAGTGC AGG Intergenic