ID: 983632057

View in Genome Browser
Species Human (GRCh38)
Location 4:169859624-169859646
Sequence ACATATAAACAACAGTGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983632057_983632068 27 Left 983632057 4:169859624-169859646 CCACCTCACTGTTGTTTATATGT No data
Right 983632068 4:169859674-169859696 ATTTCTAAGAGCAATACTGTTGG No data
983632057_983632069 28 Left 983632057 4:169859624-169859646 CCACCTCACTGTTGTTTATATGT No data
Right 983632069 4:169859675-169859697 TTTCTAAGAGCAATACTGTTGGG No data
983632057_983632061 -8 Left 983632057 4:169859624-169859646 CCACCTCACTGTTGTTTATATGT No data
Right 983632061 4:169859639-169859661 TTATATGTTGATGGCATGCAGGG No data
983632057_983632060 -9 Left 983632057 4:169859624-169859646 CCACCTCACTGTTGTTTATATGT No data
Right 983632060 4:169859638-169859660 TTTATATGTTGATGGCATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983632057 Original CRISPR ACATATAAACAACAGTGAGG TGG (reversed) Intergenic
No off target data available for this crispr