ID: 983633041

View in Genome Browser
Species Human (GRCh38)
Location 4:169869306-169869328
Sequence AATGAATCCAGTACATATGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983633041_983633042 -3 Left 983633041 4:169869306-169869328 CCTACATATGTACTGGATTCATT No data
Right 983633042 4:169869326-169869348 ATTTATTCATTTAATTTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983633041 Original CRISPR AATGAATCCAGTACATATGT AGG (reversed) Intergenic
No off target data available for this crispr