ID: 983633704

View in Genome Browser
Species Human (GRCh38)
Location 4:169876541-169876563
Sequence GAGGCCCACCAAAATTATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983633695_983633704 26 Left 983633695 4:169876492-169876514 CCACCGCACCCGGCCCCATTCTG No data
Right 983633704 4:169876541-169876563 GAGGCCCACCAAAATTATCAAGG No data
983633700_983633704 13 Left 983633700 4:169876505-169876527 CCCCATTCTGCTTTTAAGGCTTT No data
Right 983633704 4:169876541-169876563 GAGGCCCACCAAAATTATCAAGG No data
983633696_983633704 23 Left 983633696 4:169876495-169876517 CCGCACCCGGCCCCATTCTGCTT No data
Right 983633704 4:169876541-169876563 GAGGCCCACCAAAATTATCAAGG No data
983633701_983633704 12 Left 983633701 4:169876506-169876528 CCCATTCTGCTTTTAAGGCTTTC No data
Right 983633704 4:169876541-169876563 GAGGCCCACCAAAATTATCAAGG No data
983633697_983633704 18 Left 983633697 4:169876500-169876522 CCCGGCCCCATTCTGCTTTTAAG No data
Right 983633704 4:169876541-169876563 GAGGCCCACCAAAATTATCAAGG No data
983633698_983633704 17 Left 983633698 4:169876501-169876523 CCGGCCCCATTCTGCTTTTAAGG No data
Right 983633704 4:169876541-169876563 GAGGCCCACCAAAATTATCAAGG No data
983633702_983633704 11 Left 983633702 4:169876507-169876529 CCATTCTGCTTTTAAGGCTTTCA No data
Right 983633704 4:169876541-169876563 GAGGCCCACCAAAATTATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983633704 Original CRISPR GAGGCCCACCAAAATTATCA AGG Intergenic
No off target data available for this crispr