ID: 983640375

View in Genome Browser
Species Human (GRCh38)
Location 4:169939548-169939570
Sequence ATTAATAGCCTGCTGCTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983640370_983640375 18 Left 983640370 4:169939507-169939529 CCACATCTGGCCCATATATAACT No data
Right 983640375 4:169939548-169939570 ATTAATAGCCTGCTGCTGACTGG No data
983640369_983640375 21 Left 983640369 4:169939504-169939526 CCACCACATCTGGCCCATATATA No data
Right 983640375 4:169939548-169939570 ATTAATAGCCTGCTGCTGACTGG No data
983640372_983640375 7 Left 983640372 4:169939518-169939540 CCATATATAACTTATGACTGCCC No data
Right 983640375 4:169939548-169939570 ATTAATAGCCTGCTGCTGACTGG No data
983640371_983640375 8 Left 983640371 4:169939517-169939539 CCCATATATAACTTATGACTGCC No data
Right 983640375 4:169939548-169939570 ATTAATAGCCTGCTGCTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983640375 Original CRISPR ATTAATAGCCTGCTGCTGAC TGG Intergenic
No off target data available for this crispr