ID: 983640759

View in Genome Browser
Species Human (GRCh38)
Location 4:169942127-169942149
Sequence TTGAAAAAGCAGAAGCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983640753_983640759 25 Left 983640753 4:169942079-169942101 CCTGAAGTGGTGTAGGAAACACT No data
Right 983640759 4:169942127-169942149 TTGAAAAAGCAGAAGCAGGAAGG No data
983640756_983640759 1 Left 983640756 4:169942103-169942125 CCTCAAAATATGGCACCTTGGAA No data
Right 983640759 4:169942127-169942149 TTGAAAAAGCAGAAGCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983640759 Original CRISPR TTGAAAAAGCAGAAGCAGGA AGG Intergenic
No off target data available for this crispr