ID: 983641043

View in Genome Browser
Species Human (GRCh38)
Location 4:169944084-169944106
Sequence AGACACCGAGTTAAAGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983641043_983641051 24 Left 983641043 4:169944084-169944106 CCTCCTTCTTTAACTCGGTGTCT No data
Right 983641051 4:169944131-169944153 CTGCTACAAAATGTGGAAAGTGG No data
983641043_983641048 -5 Left 983641043 4:169944084-169944106 CCTCCTTCTTTAACTCGGTGTCT No data
Right 983641048 4:169944102-169944124 TGTCTGAGGGGTTTCGTCTGCGG No data
983641043_983641052 25 Left 983641043 4:169944084-169944106 CCTCCTTCTTTAACTCGGTGTCT No data
Right 983641052 4:169944132-169944154 TGCTACAAAATGTGGAAAGTGGG No data
983641043_983641049 17 Left 983641043 4:169944084-169944106 CCTCCTTCTTTAACTCGGTGTCT No data
Right 983641049 4:169944124-169944146 GCTTGTCCTGCTACAAAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983641043 Original CRISPR AGACACCGAGTTAAAGAAGG AGG (reversed) Intergenic