ID: 983647125

View in Genome Browser
Species Human (GRCh38)
Location 4:170003367-170003389
Sequence CTCCATTTTCTTTTGTTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1024
Summary {0: 2, 1: 0, 2: 3, 3: 93, 4: 926}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983647125_983647129 26 Left 983647125 4:170003367-170003389 CCCACAAACAAAAGAAAATGGAG 0: 2
1: 0
2: 3
3: 93
4: 926
Right 983647129 4:170003416-170003438 TGCCCTCAATACACAGATGAAGG 0: 1
1: 0
2: 2
3: 11
4: 197
983647125_983647133 30 Left 983647125 4:170003367-170003389 CCCACAAACAAAAGAAAATGGAG 0: 2
1: 0
2: 3
3: 93
4: 926
Right 983647133 4:170003420-170003442 CTCAATACACAGATGAAGGAGGG 0: 1
1: 0
2: 1
3: 21
4: 228
983647125_983647132 29 Left 983647125 4:170003367-170003389 CCCACAAACAAAAGAAAATGGAG 0: 2
1: 0
2: 3
3: 93
4: 926
Right 983647132 4:170003419-170003441 CCTCAATACACAGATGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983647125 Original CRISPR CTCCATTTTCTTTTGTTTGT GGG (reversed) Intronic
900279972 1:1860636-1860658 CTCTTTTTTTTTTTTTTTGTTGG - Intronic
901548456 1:9977249-9977271 CTTTATTTTCTTTTTTTTGTTGG + Intronic
902055735 1:13599008-13599030 CTCCTTTTTTTTTTTTTTTTTGG + Intronic
902183971 1:14711340-14711362 CTCAATTTTTTTTTTTTTTTTGG - Intronic
902452193 1:16503556-16503578 TTCCATTTTCTTTCCTTTGTTGG + Intergenic
902500756 1:16910101-16910123 TTCCATTTTCTTTCCTTTGTTGG - Intronic
904056434 1:27673627-27673649 CTCCATTATCTGTTGGTTGCTGG + Intergenic
905371269 1:37483752-37483774 CTACAGTATCTTTGGTTTGTGGG - Exonic
905438100 1:37973178-37973200 TTTCTTTTTCTTTTTTTTGTTGG - Intronic
906045374 1:42826332-42826354 ATCCCTTTTTTTTTGTTTGATGG - Intronic
906183991 1:43846496-43846518 TTGCAATTACTTTTGTTTGTGGG + Intronic
906887765 1:49670285-49670307 TTTCATTTTGTTTTGTTTTTTGG - Intronic
906951512 1:50337799-50337821 CTCCATTATCTTTTCTTTTATGG + Intergenic
907060933 1:51423993-51424015 CTCCATATTTTTTTTTTAGTTGG - Intronic
907363861 1:53944640-53944662 CTGCACTTTGTTTTGTTTTTTGG - Intronic
907792444 1:57680461-57680483 CTTCCTTTTCCATTGTTTGTAGG + Intronic
907871289 1:58445804-58445826 CTCCTTTCTCTTATGTTTTTTGG - Intronic
907976935 1:59440392-59440414 CTCTGATCTCTTTTGTTTGTGGG + Intronic
908219221 1:61986817-61986839 TTTTATTTTGTTTTGTTTGTTGG + Intronic
908451699 1:64262500-64262522 ATCCATTTTCTTCTGTCTTTAGG + Intronic
908602795 1:65759254-65759276 CTCAAATTTCTGTTTTTTGTGGG - Intergenic
909160333 1:72139933-72139955 CTCCACTTTCTTTGGTATTTGGG + Intronic
909483295 1:76148381-76148403 CTATATTTTCTTTTCTTTTTGGG + Intronic
909565519 1:77049139-77049161 CTCTATTTTTTTTTCTTTTTTGG + Intronic
909576186 1:77179024-77179046 CTCCATTTTTTGTGGTCTGTTGG - Intronic
910555320 1:88525425-88525447 CTCCATATTCTTTTCTGTATTGG - Intergenic
910569778 1:88685729-88685751 CTGCATTTCTTTTTGTGTGTTGG + Intronic
910782343 1:90953294-90953316 CACCATTTTTTTTTTTTTTTTGG + Intronic
910787227 1:91013070-91013092 ATCTTTTTTCTTTTGTTTTTTGG + Intronic
911011402 1:93284826-93284848 TTCCATTTTATTTTCTTTTTGGG - Intergenic
911017578 1:93350418-93350440 CTCCATTTTCTTTTGTTTGTGGG - Intronic
911051448 1:93675000-93675022 TTCCATTTCCTTTTGTAAGTAGG - Intronic
911336100 1:96582331-96582353 CTCCATTTTCCTTTTAGTGTTGG + Intergenic
911338971 1:96614400-96614422 CTGGACTTTCTTTTGTTGGTAGG + Intergenic
911978070 1:104528113-104528135 CTGCAATGTCTTTTGTTTTTTGG - Intergenic
912244417 1:107945912-107945934 TGCCATTTTCTTTTGTTTCTTGG - Intronic
913105366 1:115609423-115609445 CTCCTTTTTTTTTTTTTTTTTGG - Intergenic
913305596 1:117428109-117428131 CTCTATTTTTTTTTTTTTGGGGG + Intronic
913378504 1:118183490-118183512 CTCAATTTTCTTCAGTTTGTTGG - Intronic
913708604 1:121455316-121455338 CTCCAATTTCTTTGGTCTTTGGG + Intergenic
914004291 1:143718819-143718841 TTCCATTTTCTTTCCTTTCTTGG + Intergenic
914200150 1:145477112-145477134 TTCCATTTTCTTTCCTTTTTTGG + Intergenic
914516726 1:148380498-148380520 TTCCATTTTCTTTCCTTTTTTGG + Intergenic
914722929 1:150304307-150304329 CACCATTTTTTTTTTTTTGTAGG - Intronic
915031790 1:152886190-152886212 CTGCACTTTGTTTAGTTTGTGGG + Intergenic
915176210 1:154017280-154017302 CCCCCTTTTTTTTTTTTTGTTGG - Intronic
915411267 1:155702574-155702596 GTCCATTTTCATTCTTTTGTGGG + Intronic
915765687 1:158359614-158359636 CTGCATCTTTCTTTGTTTGTAGG - Intergenic
915972514 1:160364632-160364654 CTCCTTTTTTTTTTTTTTGACGG + Intergenic
916719764 1:167475481-167475503 TTCCTTTTTCATTTGTTTGCTGG - Intronic
917370473 1:174288405-174288427 CTCCTTTAGTTTTTGTTTGTTGG + Intronic
917561010 1:176155623-176155645 CTTTATTTTATTTTGTTTTTTGG - Intronic
917741783 1:177968039-177968061 TTCCTTTTTCTTTTGTCTGCAGG - Exonic
917775892 1:178334009-178334031 CTACATTGTGTTTTCTTTGTGGG + Intronic
917817223 1:178723920-178723942 TTCCTTTTTCTTTTCTTTTTTGG + Intergenic
917855422 1:179095395-179095417 ATCCTTTTTCTTTTTTTTGGAGG + Exonic
918616725 1:186552832-186552854 TTCCCTCTGCTTTTGTTTGTCGG - Intergenic
918952506 1:191157796-191157818 CTCCATTTTCATTTATCTGAAGG - Intergenic
919068452 1:192723664-192723686 CTCTATTTTTTTTTTCTTGTGGG - Intergenic
919098862 1:193069038-193069060 CTCCATTTTTTTTTGTCTTTAGG - Exonic
919179627 1:194063535-194063557 CTCTCTTTTCTTTTTTTTTTTGG + Intergenic
919193051 1:194248191-194248213 TTACATTTTTTTTTTTTTGTAGG - Intergenic
919686660 1:200489293-200489315 TTTCCTTTTCTTTTTTTTGTGGG + Intergenic
920358436 1:205393855-205393877 TTCCATTTTTTTTTTTTTTTTGG - Intronic
921189303 1:212695706-212695728 TTCCATGTTCTTGTCTTTGTCGG - Intronic
921995137 1:221409993-221410015 CTACATTTTTTTTTTTTTTTGGG - Intergenic
922244288 1:223779395-223779417 CTTCCTTTTCTTTTTTTTTTGGG - Intergenic
922275765 1:224076518-224076540 CTCCATTTACTATTGATTTTGGG - Intergenic
922863434 1:228838721-228838743 CTCCATGTGGTTTTGTTTGGTGG + Intergenic
923004000 1:230030645-230030667 CTCCATTTTGGTTGGTCTGTAGG + Intergenic
923821291 1:237445557-237445579 CTTCATTTTCATTTCTTTATTGG + Intronic
924288492 1:242512602-242512624 CTCCATTTTCATTAGTCTGGAGG - Intronic
924429965 1:243988432-243988454 CTGCATTTTCTCCTGTTTGGGGG - Intergenic
924810028 1:247392772-247392794 CTGCATTTTTTTTTTTTTTTTGG + Intergenic
1062816697 10:506230-506252 CTCCATTTTCTCCTGCTTGCAGG + Intronic
1063147814 10:3312135-3312157 TTCATATTTCTTTTGTTTGTTGG - Intergenic
1063160874 10:3417196-3417218 CTTCTGTTTCTTTAGTTTGTAGG - Intergenic
1063262697 10:4408069-4408091 TTCCATTTGCATTTGCTTGTAGG - Intergenic
1063407574 10:5812486-5812508 CGCCTTTTCCTTTTGTTTGGTGG - Intronic
1063691764 10:8294595-8294617 CTTCATTTTGCTTTGTTAGTAGG + Intergenic
1063763918 10:9114892-9114914 TTTGATTTTCTTTTATTTGTTGG + Intergenic
1064366424 10:14712610-14712632 CTTCTTTTTTTTTTGTTTTTTGG - Intronic
1064731937 10:18340086-18340108 TTCCATGTTCTTTTAGTTGTGGG + Intronic
1064802929 10:19096560-19096582 GTTCATTTGCTTTTGTTTGGTGG + Intronic
1064822215 10:19350173-19350195 ATCAATTTTTTTTTCTTTGTAGG + Intronic
1065207717 10:23373040-23373062 CTCCTTTTTCTTTTTTTTTTTGG + Intergenic
1065249823 10:23799479-23799501 TTCCATTTTCCTTTGATTTTTGG + Intronic
1065404900 10:25352749-25352771 AACCATTTAATTTTGTTTGTTGG + Intronic
1065549752 10:26858861-26858883 CTCCTTTTTGTTTTGCATGTTGG - Intronic
1065697691 10:28394923-28394945 CAACATTTTCTTTTGTTTTGGGG + Intergenic
1065768192 10:29051948-29051970 CTGCATTTTCTTTTTCTTATAGG - Intergenic
1065907257 10:30267575-30267597 CTTCATTTTTTTTTTTTTTTTGG - Intergenic
1066495746 10:35940209-35940231 CTCCTTTTTTTTTTTTTTTTTGG - Intergenic
1067582627 10:47455239-47455261 CTCCATTCTCTTTACTTTCTGGG + Intergenic
1067826858 10:49581272-49581294 CTCAATTTTATTTTATCTGTTGG - Intergenic
1068113042 10:52704138-52704160 CTCCATTTTCTGTGGTTTTACGG + Intergenic
1068649152 10:59502340-59502362 CTTTTTTTTCATTTGTTTGTTGG - Intergenic
1068804168 10:61175941-61175963 CACCATTCTCTTTATTTTGTGGG - Intergenic
1068844902 10:61660980-61661002 CTCCCATTTCTTTTGTAGGTAGG - Intergenic
1069206633 10:65697225-65697247 TTCTATTTTATTTTGTTTGTTGG - Intergenic
1069302065 10:66920523-66920545 ATCCATTTGCTATTGTTTGGGGG + Intronic
1070276484 10:75012444-75012466 CTCCTTTTTCTTTTATTTTTTGG - Intronic
1070679823 10:78440708-78440730 CTCCAATTTCCTATGTTTATGGG + Intergenic
1070897001 10:79993304-79993326 CTCCAATCTCTTTGGCTTGTAGG + Intergenic
1070937383 10:80310877-80310899 CTTCATTTTCTTTTATTTCTAGG - Intergenic
1070967326 10:80537565-80537587 TTCCATTTTGTTTTCTTTCTTGG + Intergenic
1071112899 10:82182787-82182809 CTCCATTAGCATTTTTTTGTAGG + Intronic
1071276912 10:84063956-84063978 CACCACTTTCTTTTTTTTGTTGG - Intergenic
1071316426 10:84404282-84404304 CTCCAGTTCCTTTTGTTGATGGG + Intronic
1071698628 10:87904584-87904606 CTCCTTTTTCTTTTCTTTGTTGG + Intronic
1071864709 10:89714933-89714955 TTTCTTTTTCTTTTTTTTGTAGG + Exonic
1071996200 10:91151990-91152012 CTGCATTTTTTTTTTTTTTTTGG + Intergenic
1072075005 10:91961865-91961887 CTCATTTTCCTTTTGGTTGTCGG + Intronic
1072334718 10:94387676-94387698 TTTCTTTTTCTTTTTTTTGTTGG - Intergenic
1072381273 10:94873718-94873740 CAACATTTTCTTTTGTTTAATGG - Intergenic
1072725991 10:97814410-97814432 CTCCAGCTTCTTGGGTTTGTAGG + Intergenic
1073335805 10:102707911-102707933 TTCCTTTTTCTTTTTTTTGGGGG + Intronic
1073410415 10:103337281-103337303 CTCTATTTTCTTTGGTATGCAGG + Intronic
1073829356 10:107363983-107364005 CTGTATTTTCTCTTCTTTGTAGG + Intergenic
1074040502 10:109783748-109783770 ATCCATTTTCTTATGGTTGTAGG - Intergenic
1074409778 10:113217459-113217481 TTCCATTTTTTCTTGTTTTTTGG + Intergenic
1074489178 10:113923632-113923654 GCCATTTTTCTTTTGTTTGTGGG - Intergenic
1074992603 10:118723772-118723794 CACCATTTTTTTTTCTTTTTGGG + Intronic
1075117752 10:119641050-119641072 CTCCCTTTTTTTTTTTTTTTGGG - Intergenic
1076038100 10:127218365-127218387 TTCCATTTTTTTTTGGTTGGAGG + Intronic
1077290878 11:1791911-1791933 TTCCATTTTATTTTCTTTGATGG + Intergenic
1077621667 11:3730353-3730375 TTACATTTTCTTTTTTTTTTTGG + Intronic
1078591679 11:12646488-12646510 CTAGATTTTTGTTTGTTTGTTGG - Intergenic
1078730291 11:13967475-13967497 GGCCAATTCCTTTTGTTTGTGGG + Intronic
1078980899 11:16533340-16533362 CTCCATTTTGTTTAGTTTTTAGG - Intronic
1079512235 11:21224958-21224980 CTTCATTTGCTTTTGTGTGTTGG + Intronic
1079863577 11:25706078-25706100 TTTCATTCTTTTTTGTTTGTGGG + Intergenic
1080601571 11:33825843-33825865 CTCTCTTTTTTTTTTTTTGTAGG + Intergenic
1080716968 11:34812321-34812343 CTCCACTATCTTGGGTTTGTTGG + Intergenic
1081002443 11:37692000-37692022 ATTTATTTTCTTGTGTTTGTAGG - Intergenic
1082887717 11:58105475-58105497 GTCCCTTTTCCTTTTTTTGTGGG + Intronic
1083153842 11:60810473-60810495 CTCCATTTTATTTTTTTGATGGG + Intergenic
1083337875 11:61936780-61936802 CTTAATCCTCTTTTGTTTGTTGG - Intergenic
1083555958 11:63628318-63628340 CTCTATTTTTTTTTTTTTTTTGG - Exonic
1083699309 11:64464604-64464626 CTGCATTTTTTTTTTTTTCTTGG + Intergenic
1083910341 11:65704732-65704754 GCACCTTTTCTTTTGTTTGTTGG - Intergenic
1083911587 11:65713095-65713117 CTCCTATTTCTCTTGTCTGTTGG + Intronic
1083973340 11:66096998-66097020 CCCCATTTTCATTTCTTTGGGGG + Intronic
1084370921 11:68742576-68742598 CTCATTTTTCTTTTCTTTTTTGG + Intronic
1084467268 11:69332957-69332979 CTTCATTTTATCTTATTTGTTGG + Intronic
1085013046 11:73154572-73154594 CTCCAATTTCTAGGGTTTGTGGG - Intergenic
1085368078 11:75971682-75971704 GTTCATTTTCTTTTTTTTTTTGG + Intronic
1085934820 11:81128308-81128330 CTACAATTATTTTTGTTTGTTGG - Intergenic
1085976052 11:81656700-81656722 CTCTATTTTCATTTGTTTCAAGG + Intergenic
1086751315 11:90497345-90497367 CTCAATTTTTTTTTTTTTTTTGG + Intergenic
1087491615 11:98834571-98834593 CTCATTTTTATTTTGTTTTTAGG - Intergenic
1087516305 11:99166750-99166772 TTCCTTTTTCTTTTTTTTTTTGG + Intronic
1087578248 11:100017859-100017881 CTGCATTATCTTTAGTCTGTGGG + Intronic
1087651987 11:100878523-100878545 ATCTAATTTCATTTGTTTGTGGG + Intronic
1087898905 11:103618465-103618487 CTCCATTATCATTAGTTTGGTGG + Intergenic
1087901007 11:103641075-103641097 CACCATTTTCTTTTCTGTGAAGG - Intergenic
1087985549 11:104675358-104675380 CTATTTTTTCTTATGTTTGTTGG - Intergenic
1088236269 11:107727723-107727745 CTCCTTTTTTTTTTATTTTTGGG + Intergenic
1088253545 11:107882102-107882124 CTGAGTTTTCTTTTGTTTGGAGG + Intronic
1088772287 11:113047421-113047443 CTTTATTTTCTGTTATTTGTTGG - Intronic
1088800530 11:113302651-113302673 GTATATTTTCTTATGTTTGTTGG - Intergenic
1089192592 11:116664134-116664156 ATTCATGTTCTTTTGTTTTTGGG - Intergenic
1090087185 11:123660928-123660950 CTCCTTTTTTTTTTTTTTGAGGG + Intergenic
1090122385 11:124045156-124045178 GTAGATTTTCTTTTGTTTATTGG + Intergenic
1090281622 11:125461155-125461177 CTCTATTTTCATTTGTTGCTGGG - Intronic
1090735551 11:129609663-129609685 ATCCAACTTCTTTTGTTTCTTGG + Intergenic
1090741969 11:129670559-129670581 CCCCATTTTATTTTCTTTGTTGG - Intergenic
1091111960 11:132978030-132978052 CTCCATTCTTTTTGTTTTGTTGG - Intronic
1091682791 12:2539095-2539117 CTACACTTTCTTTTGTCAGTGGG + Intronic
1092523529 12:9295697-9295719 CACCATTTTGTTTTCCTTGTAGG - Intergenic
1092543767 12:9436202-9436224 CACCATTTTGTTTTCCTTGTAGG + Intergenic
1092719139 12:11423587-11423609 CTTCATTTTTTTTTTTTTTTTGG + Intronic
1092931186 12:13317330-13317352 CTCCAATTTCTGTGCTTTGTGGG - Intergenic
1093060683 12:14599847-14599869 CTCCATTTTTTGTTTTTTGGTGG + Intergenic
1093355400 12:18160626-18160648 CTCAATTGTCTTTTGGTTGCAGG - Intronic
1093381932 12:18503594-18503616 CTGCATTTTATTTAGTTTCTGGG + Intronic
1093387305 12:18573682-18573704 CTCCATTTTCTGGTGATAGTAGG - Intronic
1093454488 12:19351665-19351687 CTCCAGCTTCTTTTCTTTTTTGG - Intronic
1093880495 12:24398606-24398628 CTCAACATTCTTTTGTTTTTAGG - Intergenic
1093935612 12:24997092-24997114 ATACTTTTTCTTTTGTTTTTTGG - Intronic
1094509178 12:31085849-31085871 CACCATTTTGTTTTCCTTGTAGG - Intronic
1095717135 12:45358780-45358802 CTCCTTTTTTTTTTTTTTGGTGG + Intronic
1095878329 12:47105898-47105920 CTTCATTTTCTTGTGAGTGTTGG + Intronic
1096096302 12:48937916-48937938 CTTCATTCTCTTTTGTTATTAGG - Exonic
1096442547 12:51656728-51656750 ATGCATTTTCTCATGTTTGTTGG - Intronic
1096612387 12:52811156-52811178 CTCCATTTCCCTTTGTTTGGTGG + Intronic
1096767592 12:53906148-53906170 ATCCATTTAATTTTGTTTGGTGG + Intergenic
1096925249 12:55136826-55136848 CTCAATTTTTTCTTGTTTGTAGG - Intergenic
1097270576 12:57771672-57771694 CATCTTTTGCTTTTGTTTGTTGG - Intronic
1097636127 12:62124422-62124444 TTCCATTTTCTTTTATTTCTTGG - Intronic
1097827159 12:64185825-64185847 CTAAATGTTCTTTTGTTTGTTGG - Intergenic
1097852886 12:64430939-64430961 TTCTTTTTTCTTTTTTTTGTGGG + Intronic
1098178797 12:67822920-67822942 CTGCATTTTCTTCTGTCTGTTGG + Intergenic
1098541813 12:71665133-71665155 CTAGGTTTTCTTTTGTTTGCTGG + Intronic
1098761704 12:74433674-74433696 CTCCAGTTTTTTCTGTTTATGGG - Intergenic
1098889040 12:75989761-75989783 ATTCATTGTTTTTTGTTTGTTGG - Intergenic
1099172364 12:79380180-79380202 CTGCATTTTCTCTTATTTTTTGG - Intronic
1099690029 12:85940139-85940161 CTCCAATTTCTTTAGTTTTTGGG + Intergenic
1099711540 12:86232133-86232155 CTCCTTTTTTTTTTCTTTTTTGG - Intronic
1100374532 12:94001747-94001769 CCTCATTTTCGTTTGTATGTGGG + Intergenic
1100501647 12:95180075-95180097 CTCCTTTTTTTTTTTTTTGGAGG - Intronic
1100687943 12:97007037-97007059 CCCCTATTTCTTTTGTTTTTGGG + Intergenic
1100765268 12:97857369-97857391 TTCCATTTTCATTTGTTTCAAGG - Intergenic
1100822239 12:98442308-98442330 CTCCACCTTTTTTTGTTTGTTGG - Intergenic
1100828107 12:98493599-98493621 CTCTATTTTGGTTTGTCTGTTGG - Intronic
1100866221 12:98860007-98860029 TTCCATTTGCATTTGTTTCTGGG - Intronic
1101079157 12:101164331-101164353 ATACATTTTCATTTGTTTGTTGG - Intronic
1101164155 12:102010773-102010795 CTACTTTGTCTTTTGTCTGTGGG - Intronic
1101235127 12:102780927-102780949 CTCTACTTTCTTTTTTTTGGGGG - Intergenic
1102267208 12:111496680-111496702 TTCCATTTTCATTTGTTTCAAGG - Intronic
1103344431 12:120239923-120239945 CTCCCTTTTTTTTTTTTTTTTGG + Intronic
1103614662 12:122144582-122144604 CTCTATTTTCTTTTATTTAGAGG - Exonic
1104335856 12:127894278-127894300 CTGCAATTTATTTTGTTCGTTGG + Intergenic
1104369750 12:128213504-128213526 CTCAATTTTATTTTGTTTTCAGG - Intergenic
1104402694 12:128489894-128489916 ATCCAGGTTCTTTTGTTTGTTGG - Intronic
1105649911 13:22365133-22365155 CTCCAGTTTTTTTTTTTTGGAGG - Intergenic
1105855171 13:24365858-24365880 TTTCTTTTTCTTTTGTTTGGAGG + Intergenic
1106276421 13:28212495-28212517 TTACATTTTCTTTTCTTTATGGG - Intronic
1106353133 13:28954406-28954428 CACAATTTTCTTTTGTTTTTAGG - Intronic
1106753677 13:32799485-32799507 TTCCTTTTTCTTTTCTTTTTTGG - Intergenic
1106930923 13:34663774-34663796 GACCATTTTCTTCTGGTTGTTGG - Intergenic
1106931073 13:34666173-34666195 CTCCATTCTCTTTGGTATATAGG - Intergenic
1107112916 13:36716959-36716981 CTTAATTGTATTTTGTTTGTGGG + Intergenic
1107333803 13:39331738-39331760 CTGCACTTTTTTTAGTTTGTAGG - Intergenic
1107437942 13:40397838-40397860 CTACATTTTTTTTTTTTTTTAGG - Intergenic
1107698701 13:43025059-43025081 CCTCATTTTTTTTTCTTTGTTGG - Intronic
1108064527 13:46564006-46564028 CACCATTTTTTTTTGTTTTTTGG - Intronic
1108159367 13:47621976-47621998 ATCCATTTTCTTCTGTTAGGAGG + Intergenic
1108218020 13:48204369-48204391 CTGCACTTTCTTTGGTTGGTAGG - Intergenic
1108365940 13:49712837-49712859 CTCAATTTTCTTTTGGTATTTGG - Intronic
1108369591 13:49754648-49754670 CTGCATTTTCTCTTTTTTTTTGG - Intronic
1108478603 13:50844184-50844206 CTCCTCCTTCTTTTGTTTGGGGG - Intergenic
1109093502 13:58080063-58080085 CTCCATTTTGTTTTGTTAATTGG + Intergenic
1109215863 13:59589176-59589198 CACCATTTTTTTTTTTTTTTTGG - Intergenic
1109221238 13:59643058-59643080 CCACATTTTCTCTAGTTTGTTGG - Intergenic
1109228767 13:59729635-59729657 ATGCATTTTTTTTTGTATGTGGG - Intronic
1109518662 13:63478482-63478504 TTAAATTCTCTTTTGTTTGTTGG - Intergenic
1109549604 13:63876160-63876182 CAAAATTATCTTTTGTTTGTTGG - Intergenic
1109723945 13:66315163-66315185 ATCCAGTTGCTTGTGTTTGTAGG - Intronic
1110000874 13:70197994-70198016 CTGAATTTTTATTTGTTTGTGGG - Intergenic
1110637216 13:77780197-77780219 CTTGATTTTGTTGTGTTTGTGGG - Intergenic
1110954240 13:81534085-81534107 CTCTATTCTTTTCTGTTTGTTGG - Intergenic
1111642066 13:90981095-90981117 CTCCATTTTCTAATTTTTATTGG + Intergenic
1111652617 13:91111184-91111206 TTCCTTTTTCTTTTTTTTTTTGG - Intergenic
1111745156 13:92259160-92259182 CTCCCTTTTCTGCTGTTGGTAGG + Intronic
1112281039 13:98063561-98063583 CTCCATTTGCTTTGGTCTGGTGG + Intergenic
1112675167 13:101693051-101693073 CTCCATTTTTTCAAGTTTGTGGG - Intronic
1112999090 13:105611315-105611337 CTCTTTGTTTTTTTGTTTGTTGG - Intergenic
1113013950 13:105806216-105806238 CTCCTTTTTCTTTGGGTTTTTGG + Intergenic
1113146036 13:107208702-107208724 CTTCATTTTTTTTTTCTTGTGGG - Intronic
1113402811 13:110010248-110010270 CTCCATTTTCCATTCCTTGTTGG + Intergenic
1113618749 13:111698949-111698971 CTCCATGTTATTTTCTTTTTAGG + Intergenic
1113624278 13:111784210-111784232 CTCCATGTTATTTTCTTTTTAGG + Intergenic
1113675659 13:112205244-112205266 TTTCATTTTCTTGTGTGTGTGGG + Intergenic
1114158288 14:20132428-20132450 GTACATTTTCATATGTTTGTTGG + Intergenic
1114518335 14:23316253-23316275 CTCCATGGTCCTTTGTTTATAGG + Intronic
1114590311 14:23858682-23858704 CACCATTTTCTTTTCTTTGGTGG + Intergenic
1114607119 14:24006799-24006821 AACCCATTTCTTTTGTTTGTGGG - Intergenic
1114888887 14:26890725-26890747 GTCCATTTTCTTATTTTTTTTGG + Intergenic
1115026707 14:28755446-28755468 CTCCTTTTTCTTTTCTTTTCAGG - Intergenic
1115346847 14:32352245-32352267 CTCCCATTTCTTTTTTTTTTTGG + Intronic
1115363948 14:32535232-32535254 CTCTCTTTTTTATTGTTTGTTGG - Intronic
1115403007 14:32984754-32984776 CTCCATTTTCTTTTGTAGGGTGG + Intronic
1115525853 14:34280008-34280030 TTTCATTTGCTCTTGTTTGTAGG - Intronic
1115734737 14:36313139-36313161 CTCCTTTTTTTTTTTTTTGGAGG + Intronic
1115760014 14:36570823-36570845 CTCCATTTTGTTTTTATTCTAGG - Intergenic
1115899914 14:38133855-38133877 CTTCATTTTATTTTGTTTCATGG + Intergenic
1116125826 14:40783904-40783926 GAGCATTTTCTTATGTTTGTTGG + Intergenic
1116217761 14:42042177-42042199 TTTCATTTTCTTTTGTCTTTAGG + Intergenic
1116755719 14:48945649-48945671 TCCCACTTTCTTTTGTTTGTTGG + Intergenic
1117009589 14:51456588-51456610 CTTTTTTTTCATTTGTTTGTTGG + Intergenic
1117402240 14:55368982-55369004 TTTCATTTTCTTTGGTGTGTGGG + Exonic
1117631944 14:57702922-57702944 CTACATTTTCTGTGGGTTGTTGG + Intronic
1117834269 14:59785927-59785949 CTCCATTGTCTTGTGACTGTTGG - Intronic
1117955664 14:61121573-61121595 CTACTTTTTCTTTTCTTTGAGGG + Intergenic
1118596562 14:67440161-67440183 CTGCATTTTCTTTATTGTGTTGG + Intergenic
1118627373 14:67672119-67672141 CTACATTTTTTTTTTTTTTTGGG + Intronic
1118754205 14:68826609-68826631 TTTCATTTTCTTTTATTTCTAGG - Intergenic
1118803796 14:69216430-69216452 CTACATTTTCTTTTTTGTGATGG + Intronic
1119529468 14:75349577-75349599 CTCCATTTCCTTTTCCTTTTGGG + Intergenic
1119976958 14:79035828-79035850 CTCAATTTATTTTTGTTTGTGGG + Intronic
1120434330 14:84461335-84461357 CTCTTTTTTCTTTTTTTTTTTGG + Intergenic
1121046229 14:90790420-90790442 TTCTATTTTATTTTGTTTTTTGG - Intronic
1121290352 14:92769417-92769439 TTCCATTTTTTTTTTTTTTTTGG - Intergenic
1121566097 14:94910323-94910345 CTCTCTTTTCTTTTCTTTCTTGG - Intergenic
1121684824 14:95827982-95828004 CAGCATTTTTTTTTTTTTGTGGG - Intergenic
1121688764 14:95859348-95859370 CTCCATATTTCTTGGTTTGTGGG + Intergenic
1121765038 14:96478904-96478926 ATCCTTTTTTTTTTTTTTGTGGG + Intronic
1121767980 14:96503413-96503435 CGCCTTTTTCTTTTCTTGGTGGG + Intronic
1121966518 14:98311810-98311832 ATGTATTTTTTTTTGTTTGTTGG - Intergenic
1123950337 15:25265978-25266000 TTCCATTTTGTCATGTTTGTGGG + Intergenic
1125963294 15:43851089-43851111 CTCCATCTTCTTTAGGTTGCTGG - Exonic
1126284092 15:46991524-46991546 CTTTTTTTTCATTTGTTTGTTGG + Intergenic
1126776256 15:52103096-52103118 CTCTCTATTCTTTTGTATGTTGG + Intergenic
1127859020 15:62977574-62977596 CTACATTTTTTTTTTTTCGTAGG - Intergenic
1128483011 15:68055255-68055277 CCCCATTGCCTTTTGTTTGTAGG + Intronic
1128572659 15:68746523-68746545 CTCCATTCTTTTTTTTTTTTTGG - Intergenic
1128835412 15:70805354-70805376 CTCCAGTTTCCTATCTTTGTGGG - Intergenic
1129235981 15:74224042-74224064 CTCGATTTTCTTTTATTTCAGGG + Intergenic
1129654330 15:77513729-77513751 CTCCTTTTTTTTTTTTTTGATGG + Intergenic
1130163097 15:81422059-81422081 CTGCATTTACTTTTCTTTGCTGG - Intergenic
1130400128 15:83544208-83544230 TTCCATTTTCATTTGTTTCAAGG + Intronic
1130643157 15:85698464-85698486 CTCCTTTTTTTTTTTTTTTTTGG - Intronic
1131208402 15:90471833-90471855 CTCGATTTTTTTTTTTTTCTGGG - Intronic
1131973134 15:97912680-97912702 ATGCATTTTTTATTGTTTGTGGG - Intergenic
1132441207 15:101866313-101866335 CTCTATTTTTTTGTGTGTGTGGG + Intergenic
1132624530 16:885249-885271 CTCCTTTTTATTTTCTTTCTTGG - Intronic
1132815700 16:1825572-1825594 CTCAATTTTTTTTTGTTTTTGGG - Intronic
1133572181 16:7052035-7052057 CTTCATTTTCTTTTCTTTCTAGG + Intronic
1134914338 16:18057309-18057331 CTCGATTTTCTTTTGGGGGTGGG - Intergenic
1135258866 16:20963956-20963978 CACCATCTTCTTTTGTATCTCGG - Exonic
1135627077 16:24005424-24005446 CTCCAGTTTTGTTTGTTTCTGGG + Intronic
1136541076 16:30927908-30927930 CTCCCTTTCCTTTCGTTTGGGGG - Exonic
1136673202 16:31876132-31876154 CATCAGTTTCTTTTTTTTGTAGG + Intronic
1137400366 16:48148236-48148258 CTCAATTTTTTTTTTTTTTTTGG - Intronic
1137421116 16:48334883-48334905 CTCCATTCTCATTTTTTTGTTGG + Intronic
1137510897 16:49099549-49099571 CATTTTTTTCTTTTGTTTGTTGG + Intergenic
1137973044 16:53004737-53004759 CTCCTTTTTCTTTTTTTCTTTGG - Intergenic
1138252801 16:55517450-55517472 CTCCATCTTCTTTTATTTTTTGG - Intronic
1138776662 16:59731140-59731162 CTCCAATCTCTTCTGCTTGTAGG - Intronic
1138792290 16:59920000-59920022 TTTCATTTTGTTTTGTTCGTAGG - Intergenic
1139095432 16:63699405-63699427 CTTTATTTTGTTTTGTTTTTTGG + Intergenic
1139116408 16:63959618-63959640 CTCCCTTTTTTTTTTTTTTTTGG + Intergenic
1139259673 16:65579540-65579562 CTCCATTTGATTTTATTTTTGGG - Intergenic
1139899032 16:70312261-70312283 CTCATATTTCTTTTGTGTGTGGG - Intronic
1140527655 16:75636939-75636961 CTGCATTTTTTTTTTTTTTTTGG + Intronic
1140773160 16:78224417-78224439 TTCCATTTTCTTTTTTTGGCTGG - Intronic
1141015587 16:80446252-80446274 AGCCATTTTATTATGTTTGTTGG - Intergenic
1141726167 16:85790146-85790168 CTTGATTTTTTTTTTTTTGTAGG + Intronic
1141802717 16:86322177-86322199 TTCCCTTTTCTTTTCTTTGATGG + Intergenic
1142564077 17:828092-828114 ATCCAGTTTTTTTTGTTTTTTGG + Intronic
1142570916 17:873492-873514 CTCCTTTTTTTTTTTTTTTTTGG - Intronic
1142937297 17:3345835-3345857 ATCCATTTTGTTTTGAATGTGGG - Intergenic
1143039585 17:4023871-4023893 CTGCTGTTTCTTTTGTTGGTTGG - Intronic
1144419526 17:15083586-15083608 CTCCCTCTTCTTGTGTCTGTGGG - Intergenic
1144887230 17:18471602-18471624 GTCCATTCTCTTTTGTATCTGGG - Intergenic
1144970146 17:19103548-19103570 CCCCATTTTCTGTTTTTTGTGGG - Intergenic
1144990451 17:19229715-19229737 CCCCATTTTCTGTTTTTTGTGGG - Intronic
1145144986 17:20472693-20472715 GTCCATTCTCTTTTGTATCTGGG + Intergenic
1145757272 17:27401810-27401832 CTTCATTTTCTGTTGTTGATGGG - Intergenic
1146248000 17:31308136-31308158 TTCCTTTTTCTTTTTTTTTTTGG + Intronic
1146353948 17:32118675-32118697 GTCCATTCTCTTTTGTATCTGGG - Intergenic
1146404613 17:32526602-32526624 CTTCTTTTTTTTTTTTTTGTGGG + Intronic
1146567040 17:33922320-33922342 CTTCCTTTTCTTTTCTTTGTAGG + Intronic
1147657593 17:42099386-42099408 CAGCATTTTCTTTTTTCTGTAGG - Intergenic
1148033918 17:44643461-44643483 CTCCTTTTTTTTTTTTTTTTTGG - Intergenic
1148379603 17:47185595-47185617 CTTTATTTTATTTTATTTGTTGG + Intronic
1148494035 17:48041804-48041826 GTCCATTTTTTTTTTTTTTTTGG + Intergenic
1149000470 17:51752347-51752369 CTCCATTCTGTTTTGTTTCCTGG - Intronic
1149042517 17:52206859-52206881 CTCCATTATCTTTTGCTTCTTGG + Intergenic
1149226743 17:54480223-54480245 CTCATTTTTCTTTTCTTTTTTGG + Intergenic
1149616971 17:58008674-58008696 CTCCTTTTTTTTTTTTTTGGAGG - Intergenic
1149882206 17:60303965-60303987 CCCCATTCTCTTTTTTTTGTAGG - Intronic
1149955994 17:61050605-61050627 TTCCATTTTATTTCCTTTGTTGG - Intronic
1149986902 17:61354269-61354291 CTCTCTTTCCTTTTGGTTGTGGG - Intronic
1150859791 17:68789789-68789811 CTCCAGTTTTTTTTTTCTGTTGG + Intergenic
1150981301 17:70144549-70144571 GTCCATTATATTTTGTTTATCGG - Intergenic
1151831781 17:76557058-76557080 CTTCATTTTTTTTTGTTTCTGGG - Intergenic
1152050386 17:77970233-77970255 TTACATTTTGTTTTGTTTCTTGG + Intergenic
1152827057 17:82473291-82473313 CTCTATTTTTTTTTTTTTTTTGG + Intronic
1153383753 18:4469237-4469259 CTCTTTTTTCCTTTTTTTGTGGG + Intergenic
1153421180 18:4907063-4907085 ATTTATTTCCTTTTGTTTGTGGG + Intergenic
1153557943 18:6336242-6336264 CTCCTTTTTTTTTTGCTTTTAGG - Intronic
1153856523 18:9153702-9153724 CTTCATTTTCTTTTCTTTACAGG + Intronic
1153891445 18:9519870-9519892 CTACATTTTCTTGTATTTTTTGG + Intronic
1154089940 18:11348945-11348967 TTCCATTTTCATTTGTTTCATGG - Intergenic
1154381382 18:13853231-13853253 CTTCATTTTTTTTTTTTTTTTGG - Intergenic
1155052002 18:22156639-22156661 CTCCTTTTTATTTTATTTTTTGG - Intergenic
1155057064 18:22194310-22194332 CTCCATTTTCAGTTGTCTGTGGG + Intronic
1155333654 18:24743188-24743210 ATTCATTTACATTTGTTTGTAGG + Intergenic
1155372624 18:25118656-25118678 TTCCATTATCATTTATTTGTAGG - Intronic
1155684020 18:28524793-28524815 CTGCATTTTCTTTTGTCTATTGG + Intergenic
1155880481 18:31142055-31142077 TTCCATTTTCATTTCCTTGTAGG + Exonic
1155925296 18:31649638-31649660 GAGCATTTTTTTTTGTTTGTTGG - Intronic
1157605064 18:48921245-48921267 GTCGTTTTTTTTTTGTTTGTTGG - Exonic
1157637754 18:49177716-49177738 TTCCTTTATCTTTTGTTTGTAGG + Intronic
1158068896 18:53446837-53446859 TTCCATTTTTTTCTTTTTGTTGG + Intronic
1158253763 18:55521151-55521173 TTCCATTTATTTTTGTTTCTGGG - Intronic
1158300609 18:56048036-56048058 CTCCAGATTTTTTTGTTTGATGG + Intergenic
1158704005 18:59774815-59774837 CTGGACTTTCTTTTGTTGGTAGG - Intergenic
1158705321 18:59787392-59787414 CTAATTTTTGTTTTGTTTGTTGG - Intergenic
1158829114 18:61258672-61258694 CTCCCTTTTCATTTGTCTCTTGG - Intergenic
1159319003 18:66821487-66821509 TTCCATTTTCATTTGTTTCAAGG + Intergenic
1159385646 18:67722136-67722158 CTCCATTTTCTTTTCTATAATGG + Intergenic
1159609048 18:70506521-70506543 CTGCATTTTCTCTTTTTTGGAGG + Intergenic
1159983565 18:74815129-74815151 ATCCATTTTCTTTGTTTGGTAGG - Intronic
1160354532 18:78215919-78215941 CTCCATTCTCTTTTGCATTTGGG - Intergenic
1160410481 18:78672434-78672456 CTCCATGTTTTTGTGTTTGTGGG - Intergenic
1160547912 18:79673413-79673435 TTTCATTTTCTTTTCTTTTTTGG + Intergenic
1161024635 19:2030549-2030571 CACAATTTTCTTTTTTTTTTTGG + Intronic
1161617218 19:5278182-5278204 CTCCCTTTTTTTTTTTTTTTTGG - Intronic
1161800334 19:6414044-6414066 TTCCATTTTGTTCTGTTTGGGGG - Exonic
1161866369 19:6835340-6835362 CTACATTTTTATTTGATTGTTGG - Intronic
1162065293 19:8121681-8121703 CTCCATTTTCTTTATTTTGATGG + Intronic
1162199995 19:9012941-9012963 TTTCATTTTGTTTTGTTTTTTGG + Intergenic
1162647377 19:12059694-12059716 CTCCGTTTTCTTCCCTTTGTAGG - Intergenic
1162980731 19:14237877-14237899 CTCCCTTTTTTTTTTTTTTTTGG + Intergenic
1163155039 19:15435225-15435247 TTCTGTTTTTTTTTGTTTGTTGG - Intronic
1163256673 19:16160244-16160266 CTCCTTTTTTTTTTTTTTTTTGG + Intergenic
1163455651 19:17404381-17404403 CTCCACTTTCTTTTGTCCTTGGG + Exonic
1164540113 19:29115688-29115710 CTTCATTTTTTTTTTTTTTTTGG + Intergenic
1165079684 19:33300202-33300224 CTCCCTTTCCTTTTGGTTTTGGG - Exonic
1165483290 19:36079050-36079072 CTGTCTTTTCTTTTTTTTGTGGG + Intronic
1165577430 19:36833129-36833151 ATACAATATCTTTTGTTTGTTGG + Intronic
1166160718 19:40950894-40950916 CTCCATTTTCTGTGGGCTGTGGG - Intergenic
1166262870 19:41653891-41653913 TTCTTTTTTCTTGTGTTTGTTGG - Intronic
1166362086 19:42256874-42256896 CTGCATTTTTTTTTTTTTGGAGG - Intergenic
1168519710 19:57039498-57039520 CTATTTTTTCTTTTGTTTGTTGG - Intergenic
1168661907 19:58173877-58173899 TTCCATTTTTTTTTTTTTTTAGG + Intergenic
1168664032 19:58189121-58189143 CTCATTTTTTTCTTGTTTGTGGG + Intronic
925421565 2:3717068-3717090 CTGTTTTTTCTTTTATTTGTGGG + Intronic
925560358 2:5185300-5185322 TTCCCTTTTCTTTTGTCTCTTGG - Intergenic
925629489 2:5875647-5875669 AACCATTTTCTTTTGACTGTGGG - Intergenic
925639015 2:5969539-5969561 CTCCATTTTGATTTGTTAGCAGG + Intergenic
925658406 2:6175825-6175847 CTGCATTTTTTTTTTTTTTTTGG - Intergenic
925733200 2:6937579-6937601 CTATATTGTCTTTTGTTTGAAGG + Intronic
925995092 2:9285900-9285922 TCTCATTTTCTTTTGTATGTGGG - Intronic
926182478 2:10657655-10657677 CTCCCTTTCCTTTTTTATGTGGG - Intronic
926373914 2:12207930-12207952 CTACTTTTTGTTTGGTTTGTTGG - Intergenic
926468748 2:13226444-13226466 CTTCATTCTCATTTTTTTGTGGG + Intergenic
926747645 2:16172291-16172313 TTCCATTTTATTTAATTTGTAGG - Intergenic
927691851 2:25214100-25214122 CTCAATTTTGTTTTTTTTGGGGG - Intergenic
928787963 2:34913778-34913800 CTCTATTTTTTTTTTTTTTTTGG - Intergenic
929170304 2:38926011-38926033 CTCAATTTTCTTTCTTTTCTTGG - Intronic
929311131 2:40427105-40427127 ATCCATCTTCTGATGTTTGTAGG - Intronic
929706072 2:44213235-44213257 ATCTTTTTTCTTTTCTTTGTGGG + Intronic
929756762 2:44772460-44772482 CTTCATTTTTTTTTTTTTTTTGG + Exonic
929848002 2:45552962-45552984 CTTCATTCTCATTTCTTTGTAGG - Intronic
930283220 2:49396411-49396433 CTCCATGTTCTCATGATTGTAGG - Intergenic
930330565 2:49978158-49978180 CTACATTTTCTTTTTTGTGGGGG - Intronic
930335384 2:50038848-50038870 CTAGATTTTAGTTTGTTTGTTGG - Intronic
930501572 2:52226509-52226531 CTTCATTTTCTTTTTTCTCTTGG - Intergenic
930858755 2:56047268-56047290 TTCCATTTGCTTTAGTTTGCTGG + Intergenic
931440600 2:62287629-62287651 TTACTTTTTCTTTTTTTTGTTGG + Intergenic
931956928 2:67437937-67437959 CTCCCTTCTCTTTCTTTTGTTGG + Intergenic
932247438 2:70207411-70207433 GTGAATTTTCTGTTGTTTGTTGG + Intronic
932860207 2:75283651-75283673 CTCCATCTACTTTTTTTTTTTGG + Intergenic
932924831 2:75960772-75960794 CTCCATTTTCTTTTACTCATAGG + Intergenic
932976611 2:76609240-76609262 CTACATTTGCTTTTTTTTTTAGG + Intergenic
932996782 2:76864659-76864681 CTTCATTTTTTTTTTTTTTTTGG - Intronic
933003349 2:76955698-76955720 CTGCATCTTCTTCTGTTTTTAGG - Intronic
933214103 2:79606807-79606829 TTGCATTTTATTTTCTTTGTTGG - Intronic
933240578 2:79916574-79916596 CTCCTTTTTTTTTTTTTTGACGG + Intronic
933272475 2:80248013-80248035 CTTTATTTTTTTTTTTTTGTGGG + Intronic
933823526 2:86137447-86137469 CTCCATTTTCTTTTCTTAACAGG + Exonic
933977664 2:87524841-87524863 CCAGATTTTCTTTTTTTTGTTGG + Intergenic
934168070 2:89314557-89314579 GACCATTTTTTTATGTTTGTTGG - Intergenic
934199215 2:89868024-89868046 GACCATTTTTTTATGTTTGTTGG + Intergenic
934528360 2:95067710-95067732 CTCCCTTTTTTTTTTTTTTTTGG + Intergenic
934593099 2:95575936-95575958 GCCCAGTTTCTTGTGTTTGTTGG - Intergenic
935623297 2:105147158-105147180 CCCAGTTTTGTTTTGTTTGTGGG + Intergenic
935657432 2:105436784-105436806 TTCCATTTTCTTCTTTTTGCTGG + Intronic
935718866 2:105961932-105961954 CTCCATTAGCTTTTGCTCGTTGG - Intergenic
935874535 2:107492534-107492556 CTCCATTTTCTTTGGATAGCTGG + Intergenic
935898693 2:107766764-107766786 CCCCATTCTCTTTTGTTTTCCGG - Intergenic
936636835 2:114268483-114268505 CTCCATTTTCTTCTATTCCTAGG + Intergenic
936791103 2:116153405-116153427 CTGCATTTCCTTTTGTGAGTAGG - Intergenic
936863371 2:117048881-117048903 AGCCATTTTCTTTTATTTCTAGG - Intergenic
936925663 2:117734314-117734336 CTGCATTTTTTTTTTTTTTTTGG - Intergenic
937122208 2:119448702-119448724 CTTCATTTCCTCTTGTTTCTTGG + Exonic
937793447 2:125987756-125987778 CTTTAGTTTCCTTTGTTTGTAGG + Intergenic
937924254 2:127155395-127155417 TTCCATTTTTTTTTCTATGTTGG - Intergenic
938398948 2:130972330-130972352 CTCCTTTTTCTTTTCTTTCAAGG - Intronic
938775567 2:134538488-134538510 CTCCATGTGCTAGTGTTTGTGGG - Intronic
939325128 2:140678766-140678788 CTCCCTTTTTTTTTTTTTTTTGG + Intronic
939591144 2:144065246-144065268 CTCACTTTTGGTTTGTTTGTAGG - Intronic
939624717 2:144462630-144462652 TTCCATTTTCTTTAATTTTTTGG - Intronic
939731955 2:145795927-145795949 CTCCATTTTCATTTCTTTAGTGG - Intergenic
939733092 2:145809697-145809719 CTCAATTTCCCTTTATTTGTAGG + Intergenic
939909801 2:147966156-147966178 TTCTATTTTCTTTTGTTTCTAGG - Intronic
940177406 2:150893952-150893974 CTACATTTTCACTTGATTGTTGG - Intergenic
940186428 2:150989654-150989676 CTCCTTTTTCTTCAGTTTTTTGG - Intergenic
940205222 2:151195089-151195111 TTTCATTTTCTTTTATTTTTTGG - Intergenic
940555653 2:155225355-155225377 CTGAATTTTCTTATCTTTGTAGG + Intergenic
940681522 2:156791601-156791623 CTTCATTTTCTTTTTTGTGCAGG - Intergenic
941221634 2:162788097-162788119 CTTTATTTTTTTTTCTTTGTTGG - Intronic
941234150 2:162948179-162948201 TTCCATTTTCATTTGTTTCCAGG - Intergenic
941821425 2:169847324-169847346 TTCCATTTACTCTTCTTTGTTGG + Intronic
941978822 2:171433649-171433671 CTCCATTCTTTTTTCTTTATAGG - Intronic
942140862 2:172976532-172976554 CTCTATTTTTTTGTGTGTGTGGG - Intronic
942143699 2:173003615-173003637 CTCCTTTTTTGTTTTTTTGTGGG - Intronic
942213867 2:173698931-173698953 CTCTCTTTTTTTTTTTTTGTTGG - Intergenic
942248381 2:174027278-174027300 CTCCACTTTTTTTTTTTTTTGGG + Intergenic
942295569 2:174514016-174514038 TTCCATTTTCTCTTATTTTTTGG + Intergenic
942359544 2:175157597-175157619 CTTTATTTTTTTATGTTTGTGGG - Intronic
942373380 2:175310396-175310418 CTCCTTTTTTTTTTTTTTTTGGG + Intergenic
942645290 2:178103899-178103921 CAGCATGTTTTTTTGTTTGTGGG - Intronic
943547161 2:189294796-189294818 CTCTTTTTTGTTTTGTTTTTTGG + Intergenic
943919920 2:193693017-193693039 CTCCATTTGTTTTTGCTTGTTGG + Intergenic
944333981 2:198507228-198507250 TTCCATTTTATTTCTTTTGTTGG - Intronic
944799593 2:203226666-203226688 CTGTATTTTCTTTTATTTTTGGG - Intergenic
945208139 2:207354104-207354126 CTCCTTTTTCTTTGCTTTGATGG + Intergenic
945475293 2:210274997-210275019 CTTGTTTTTCTTATGTTTGTTGG + Intergenic
945654442 2:212605875-212605897 CTCCTTCTTCTTTTTTTTTTTGG - Intergenic
945690535 2:213029199-213029221 CTCCCTTTTCTATTGTCTGGAGG + Intronic
945703499 2:213200468-213200490 CTTCATTTTCTTTTTTTTCAAGG + Intergenic
946177540 2:217930667-217930689 CTCCATCTTCTTATGTTCCTCGG - Intronic
947243894 2:228025453-228025475 TTTCATTTTCTTTTGGTTGTTGG + Exonic
947406548 2:229783498-229783520 TTTCATTTTCAGTTGTTTGTTGG - Intronic
947677297 2:231993759-231993781 CTGCATTTTTTTTTTTTTTTTGG + Intronic
948070804 2:235122526-235122548 ATCCATTTACTTCTTTTTGTTGG + Intergenic
948114736 2:235486159-235486181 CTCCTTTTTTTTTTTTTTATGGG - Intergenic
948268404 2:236655904-236655926 TTCCATTTTATTTTATTTGTAGG - Intergenic
948497809 2:238365165-238365187 CTCAAATTTCTTTTTTTGGTAGG + Intronic
949029716 2:241787537-241787559 CTCCTTTTTTTTTTTTTTTTTGG + Intronic
1168732812 20:101650-101672 TTCCCTTTTCTTTTGTAGGTTGG - Intergenic
1169583853 20:7058446-7058468 CCCCATTTTTTTTTTTTTTTTGG - Intergenic
1169660699 20:7975458-7975480 CCTCATTTTCTTTTTTTTGAGGG - Intergenic
1169726765 20:8742806-8742828 CACTATTTTATTTTATTTGTGGG + Intronic
1170441260 20:16381204-16381226 CTCACTTTTCTTTTGTGTATGGG - Intronic
1170480253 20:16758061-16758083 CTCAGGCTTCTTTTGTTTGTGGG + Intronic
1171103609 20:22410702-22410724 TTCCTTTTGCTTTTGTTTGGTGG + Intergenic
1171901986 20:30866866-30866888 CTTCTTTTTTTTTTTTTTGTGGG + Intergenic
1172399202 20:34634843-34634865 CTCTATTCTCTTTTATTTGGGGG - Intronic
1172551076 20:35800433-35800455 CTACTTCTTTTTTTGTTTGTTGG - Intronic
1173172085 20:40735572-40735594 CTTTATTTTCTTTCTTTTGTTGG - Intergenic
1173481929 20:43408332-43408354 CTCCATTTTAATTTGTTAATTGG - Intergenic
1174005575 20:47408200-47408222 ATCCACCTTTTTTTGTTTGTTGG + Intergenic
1174120141 20:48258795-48258817 TTCCATGTCCTTTTGTTTGAAGG - Intergenic
1174385313 20:50185283-50185305 TTCCATTTTTTTTTTTTTGGAGG + Intergenic
1174894341 20:54432971-54432993 CTTCATTTTTTTTTTTTTTTTGG + Intergenic
1175593155 20:60209459-60209481 CTCCATTTTCTTCAGTTTGCTGG - Intergenic
1175835528 20:61991602-61991624 CTCTCTTTTTTTTTGTTTTTTGG - Intronic
1176205641 20:63886648-63886670 CTTTTTTTTCTTTTTTTTGTTGG + Intronic
1177145242 21:17400051-17400073 CTTTCTTTTCTTTTGTTTGACGG - Intergenic
1177152837 21:17471654-17471676 CTCCCCTTTCTTTTATGTGTTGG - Intergenic
1177516321 21:22156018-22156040 TTTCATTGTCTTTTGTCTGTTGG - Intergenic
1177713508 21:24810212-24810234 GTCAATTTTATTTTGTTTTTAGG - Intergenic
1177839064 21:26216599-26216621 CTCCCTTTTTTTTTTTTTTTTGG + Intergenic
1177885272 21:26739090-26739112 CTCCCTTCACTTTTATTTGTGGG + Intergenic
1177924415 21:27196221-27196243 CTCCATTTCTTTTTCTTTTTCGG - Intergenic
1177932099 21:27298020-27298042 CTCCATTTTCTCATGTCAGTGGG - Intergenic
1178114445 21:29403171-29403193 TTCCATGTTCTTTTTTTTGGGGG - Intronic
1178318363 21:31585934-31585956 CTCCTTTTTTTTTTTTTTTTAGG - Intergenic
1178482516 21:32991858-32991880 CTCCATTTTCTTGTGCTTCCTGG - Intergenic
1178842566 21:36149581-36149603 CTCAAGTTTCTTTTATTTGGGGG + Intergenic
1179013987 21:37578971-37578993 CTGCTTTTTCTTTTGATTATGGG + Intergenic
1179158153 21:38869123-38869145 CTGCATTTTCTCTTTGTTGTTGG + Intergenic
1179203164 21:39245936-39245958 CTTCATTTTGATTTGTTTGAGGG - Intronic
1179977554 21:44877672-44877694 CTCCACATCCTTTTGTTTCTTGG - Intergenic
1181183523 22:21084442-21084464 CGCCATTTTCGTTTATTTGTAGG - Intergenic
1181285617 22:21750085-21750107 TTCCTTTTTCTTTTTTTTTTTGG + Intergenic
1181339879 22:22169752-22169774 CTTAATTTTATTTTGTTCGTAGG + Intergenic
1182797027 22:32998405-32998427 TTCTTTTTTCTTTTATTTGTTGG - Intronic
1182977429 22:34636588-34636610 CTCAATTTTTTTTTTTTTTTTGG - Intergenic
1183186039 22:36292208-36292230 CTCCATCTTCTTTTTCATGTCGG + Exonic
1183244201 22:36681138-36681160 GATCATTTTCTTTTGCTTGTTGG + Intronic
1183311749 22:37113500-37113522 CTACATTTTTTTTTTTTTTTTGG - Intergenic
1183342168 22:37287464-37287486 TTCTGTTTTGTTTTGTTTGTTGG - Intronic
1185249995 22:49796353-49796375 CTCTTTTTTCTTTTTTTTTTTGG + Intronic
949259583 3:2090066-2090088 CTCTATTTGTTTTTGTTGGTGGG + Intergenic
949331163 3:2924157-2924179 CTCCATCTTTATTTGTTTCTAGG + Intronic
949578074 3:5358420-5358442 TTCCATTATCTTTTGTGTTTTGG + Intergenic
949673635 3:6427620-6427642 CTCCCTTTTTTTTTTTTTTTTGG + Intergenic
949757892 3:7435155-7435177 CTATATTTTCTTTTTTTTTTTGG + Intronic
949808796 3:7983856-7983878 CTTCATTTTTTTTTTTTTTTTGG - Intergenic
950246093 3:11420081-11420103 TTTCATTTTCTTTTCTTTTTTGG + Intronic
950513516 3:13448185-13448207 CTAAATTTTTGTTTGTTTGTTGG + Intergenic
951301440 3:21002737-21002759 ATGCATTTTCTTTGTTTTGTGGG - Intergenic
951644674 3:24875949-24875971 CTTCAGTTTGTTTGGTTTGTTGG + Intergenic
951874029 3:27400669-27400691 ATCCATTTTCTCTTGATTGATGG - Intronic
951960084 3:28308606-28308628 GTCCATTTTCTTTAGATTTTTGG + Intronic
952356225 3:32586990-32587012 TTCCGTTTTGTTTTGTTTTTTGG + Intergenic
952379763 3:32795639-32795661 CTCCACTTTATTTTGTTTTTTGG + Intergenic
952640220 3:35584735-35584757 CTTCATTTTTTTTTTTTTTTTGG + Intergenic
952672853 3:35992550-35992572 CTCCTTTTTTTTTTTTTTTTTGG + Intergenic
952972818 3:38664440-38664462 TTCCATTTTCATTTGTTTCCAGG - Intergenic
953191882 3:40695350-40695372 CTCCAGTTTCTGTTGTGGGTAGG - Intergenic
953961257 3:47267869-47267891 CTCCTTTTTTTTTTTTTTTTTGG + Intronic
954173889 3:48827860-48827882 CTTAATTTTTTTTTGTTTTTGGG + Intronic
954493947 3:50935124-50935146 ACTAATTTTCTTTTGTTTGTTGG - Intronic
954651729 3:52168718-52168740 CACCTTTAGCTTTTGTTTGTTGG + Intergenic
954653272 3:52178273-52178295 CTCCATTTTTTTTTTTTTTTGGG - Intergenic
955003346 3:54947290-54947312 CACCCTTTTCTTCTGTTTCTTGG - Intronic
955125800 3:56110949-56110971 CTCCTAGTTCTTTTGATTGTTGG + Intronic
955285285 3:57634433-57634455 CTCCTTTTTTTTTTTTTTTTTGG - Intronic
955515268 3:59720285-59720307 TTCCCTTTTCTTTTGTTAGATGG + Intergenic
955783139 3:62507403-62507425 CTCTGTTTTCTTTTTTTTTTTGG + Intronic
955836042 3:63056495-63056517 CTCAATGTTTTTTTGTTTATTGG + Intergenic
955944822 3:64182844-64182866 CTTCATTTTCCTTTGCTTGGTGG - Intronic
956154321 3:66278990-66279012 CTGTATTTTTTTTTGTGTGTGGG + Intronic
956156743 3:66306375-66306397 CTTTTTTTTCTTATGTTTGTTGG + Intronic
956239113 3:67109131-67109153 CACCATTTGCTCTTGTTGGTTGG - Intergenic
956315228 3:67927877-67927899 CACCATTTTTTTTTTTTTGGTGG + Intergenic
956622148 3:71232584-71232606 CTTCTTTTTGTTTTTTTTGTCGG - Intronic
956668547 3:71664384-71664406 CTCCATTTTTTTTTGGTGGGGGG + Intergenic
956680271 3:71772828-71772850 CTCCGTTTTCTTTTTTATTTAGG - Exonic
957315030 3:78566007-78566029 CTCCATCTTCTCTTGCCTGTTGG - Intergenic
957501376 3:81062079-81062101 CTCCATTGTTTTTTAATTGTTGG - Intergenic
958081740 3:88754434-88754456 TTTCATTTTCTTATGTTTATTGG - Intergenic
958099251 3:88988254-88988276 CTCCAATTTTTTTTTTTTTTTGG - Intergenic
958259427 3:91362916-91362938 GTCCATTTTCTTCTGTTTAAAGG + Intergenic
959017246 3:101148851-101148873 CTCGATTTTATTTTATTTTTTGG - Intergenic
959140286 3:102477907-102477929 TTCAGTTTTCTTTTGATTGTTGG + Exonic
959222818 3:103543250-103543272 TTTCTTTTTCATTTGTTTGTTGG + Intergenic
959689781 3:109186329-109186351 CTCCTTTTTTTTTTTTTTTTTGG - Intergenic
959804713 3:110537492-110537514 TTCCATTTTTTTTTGTTGGCAGG - Intergenic
959853776 3:111123316-111123338 CTCCAAGTTCTTTTATTTTTTGG + Intronic
960457380 3:117889316-117889338 CTCCATTTTCTTGTATCTCTAGG - Intergenic
960500706 3:118434575-118434597 CCCCAAATTCTTTTGTTTATAGG + Intergenic
960679963 3:120237642-120237664 CTCCAGTTTCTTTGGCTTCTAGG + Intronic
960818976 3:121706760-121706782 TTGCATTTTGTTTTCTTTGTTGG - Intronic
961125120 3:124410313-124410335 CTGCCTTTTCTTTTGATTTTAGG - Intronic
961341838 3:126229178-126229200 TTCCATCTTCTTTTTTTTTTTGG + Intergenic
961767485 3:129222802-129222824 CTCCTTTTTTTTTTTTTTTTTGG + Intergenic
961842260 3:129724829-129724851 CTCCATTGTCTTGTGTTTCCTGG - Intronic
962174426 3:133138151-133138173 CTTCATTTTATTTTCTTTGTGGG - Intronic
962761165 3:138516368-138516390 CTCTATTATCTTTTTTTTGGGGG + Intronic
962772592 3:138627004-138627026 CCCCATTTTCTTTTGGTTGTTGG + Intronic
963037255 3:141042052-141042074 ATCCATTTTATTTCCTTTGTTGG - Intergenic
963225113 3:142854585-142854607 GAACATTTTCTTTTGTTTTTGGG + Intronic
963348448 3:144124425-144124447 CTGCATTTTTTTTTTTTTTTTGG + Intergenic
963901973 3:150741735-150741757 ATTCCTTTACTTTTGTTTGTGGG - Exonic
963959383 3:151292285-151292307 CTCCTTTTTTTTTTTTTTTTTGG + Intronic
964084666 3:152801801-152801823 CATTTTTTTCTTTTGTTTGTTGG + Intergenic
964348914 3:155783463-155783485 CTACATTTTTTTTTTTTTTTTGG + Intronic
964402173 3:156310982-156311004 CTCCATTTTCTTCATTTTCTTGG + Intronic
964706709 3:159626317-159626339 CTTCCTTTTCTTTTGTTCTTTGG - Intronic
964913982 3:161817179-161817201 TTCCATTTTTTTTTTTTTGCAGG - Intergenic
965155844 3:165054218-165054240 CTATATTTTCTTTGGTTTTTAGG - Intronic
965303060 3:167028276-167028298 TTCTATGTTCTTTTCTTTGTAGG - Intergenic
965448330 3:168804452-168804474 TTGCATTTTCTTTTTCTTGTCGG - Intergenic
965716415 3:171609120-171609142 CAGCATTTTTTTATGTTTGTTGG - Intronic
965779001 3:172263973-172263995 CTTCATTTTCTTTTCTTTTATGG + Intronic
965884472 3:173427510-173427532 TTCCATTTTCATTTGTTTCAAGG + Intronic
966053591 3:175653296-175653318 CACCATTTTCTTTAGTTTCAGGG + Intronic
966168837 3:177053918-177053940 ATGCCTTTTCTTTTGTTTTTAGG - Exonic
966456942 3:180128151-180128173 CTGCATTTGCTTTTTTTTGGGGG - Intergenic
966529738 3:180962861-180962883 CTCTTTTTTGTTTTGATTGTAGG + Exonic
966655433 3:182352119-182352141 CTCTATTTTTTTTTATTTTTTGG - Intergenic
966674864 3:182573755-182573777 TTCCATTTTCTTTTCCTTCTGGG - Intergenic
967476848 3:189931740-189931762 ATTCATTTTGTTTTGTATGTGGG + Intergenic
967484218 3:190011271-190011293 CTCTATTTTTTTTTTTTTTTTGG - Intronic
967645144 3:191913791-191913813 CTGCATTTTGTTTTATTTCTCGG + Intergenic
967934890 3:194719282-194719304 CGTCATTTTCTTTTGACTGTGGG + Intergenic
968821881 4:2859919-2859941 CTCCATTTTTTTTTTTTTTCAGG + Intronic
969120566 4:4906745-4906767 TTCCATTTTCATTTGTTTCAAGG - Intergenic
969398989 4:6941125-6941147 GTCCATTTCCTTCTGTTGGTGGG + Intronic
970075888 4:12219538-12219560 AATCATTTTCTTTTCTTTGTTGG - Intergenic
970462223 4:16285834-16285856 CTCCTTTTTTTTTTTTTTTTTGG - Intergenic
970692515 4:18635720-18635742 ATCCTCTTTCTTTTGTGTGTTGG + Intergenic
971403446 4:26297941-26297963 CTCCATTAACTTTTCTTTTTTGG + Intronic
971745256 4:30571596-30571618 CTCCATTCTCTTTTGAGAGTAGG - Intergenic
971895961 4:32594428-32594450 CTCTTTCTTATTTTGTTTGTAGG - Intergenic
971941848 4:33225712-33225734 CTCCATTTTATTTTTTATTTTGG + Intergenic
972541056 4:40039719-40039741 CTCCTTTTTTTTTTTTTTGATGG - Intergenic
972619485 4:40733198-40733220 CTTCCTTTTCTTTTTTTTTTTGG + Intergenic
973941185 4:55912035-55912057 CACAATTTTCTTTACTTTGTGGG - Intergenic
974194515 4:58555014-58555036 CTTCCTTTTCTTTTGGTTTTTGG + Intergenic
974292557 4:59951499-59951521 TTCCATTTTCATTTGTTTCAAGG - Intergenic
974501516 4:62710920-62710942 CTCCTTTTTGTTTTGTTTCTTGG + Intergenic
974790079 4:66676758-66676780 TTCTATTTCCTTTTGTTAGTTGG - Intergenic
974818091 4:67031971-67031993 CGCCATCTTCTTTTCTTAGTAGG + Intergenic
974875185 4:67694924-67694946 AGCCATTTTCTTTTGTTTGACGG - Intronic
974903385 4:68029157-68029179 CTCCTTTTTTTTTTTTTTTTTGG + Intergenic
974968218 4:68791261-68791283 CTCCTTTTTGCTTTGCTTGTAGG - Intergenic
975572728 4:75834653-75834675 CTCCATTTTGGTTTGGTTGTTGG + Intergenic
975631805 4:76411519-76411541 ACCCACTTTCTTTTGTTAGTGGG - Intronic
975754597 4:77560051-77560073 TTTCTTTTTCTTTTTTTTGTTGG + Intronic
975793447 4:77982096-77982118 GTCCATTTTTTTTTAATTGTGGG + Intergenic
976153774 4:82120276-82120298 CTCTATTTTTTTTTTTTTTTTGG - Intergenic
976308401 4:83584310-83584332 CTGCATTTTCTTTTTGTTCTTGG - Intronic
976377849 4:84365218-84365240 CCCCATTTTTTTTTTTTTTTTGG - Intergenic
976434361 4:84999817-84999839 CTCCATTTTTTTTTTTTTTGAGG - Intergenic
976638668 4:87313722-87313744 CTTCATTTTCTTCTATTAGTTGG + Intronic
976753694 4:88476917-88476939 TTCCATGTTCTTTTTTTTTTGGG - Intronic
977092442 4:92694964-92694986 TTTCATTTTGTTTTGTTTTTTGG + Intronic
977211526 4:94223564-94223586 TTCCTTTTTCTTTTTTTTTTTGG + Intronic
977254178 4:94722012-94722034 CTCCATGTTTTTTTTTTTTTTGG + Intergenic
977375367 4:96196520-96196542 CTCCTTTTTCTTGTGCTTCTTGG + Intergenic
977510914 4:97961586-97961608 CATCATTTTCATATGTTTGTTGG - Intronic
977804555 4:101281379-101281401 CAGCATTTTCTATTCTTTGTTGG - Intronic
977881929 4:102214893-102214915 CTCCCTTTTCATTTGTCTTTAGG + Intergenic
978170345 4:105662235-105662257 CTCCTTTTTCTTTGGGTTCTTGG + Intronic
978683091 4:111406549-111406571 TTCCTTTTTCTTTTTTTGGTAGG - Intergenic
978814453 4:112886879-112886901 CTGCATTTTTTTGTGATTGTAGG - Intronic
979643619 4:123040076-123040098 ATTCATTTTCTTTTGTATATTGG + Intronic
979840508 4:125434223-125434245 CTTGATTTTCTTTTCTTTTTAGG + Exonic
979853754 4:125606505-125606527 CTCCAATTTCTTATGTTACTAGG - Intergenic
980110574 4:128632684-128632706 TTCCATTTTCTTTTTCTTCTTGG + Intergenic
980287421 4:130798504-130798526 CTCAATTGTCTTTTGCTTGTAGG + Intergenic
980490584 4:133521893-133521915 CTGAATTTTGTTTTGTTTTTTGG - Intergenic
980631495 4:135441451-135441473 TTCCATTTTCATTTGTTTCAAGG - Intergenic
981082141 4:140645996-140646018 TTGCATTTGTTTTTGTTTGTTGG + Intronic
981340408 4:143615732-143615754 TTCAATTTTGTTTTGTTTGTGGG - Intronic
981985617 4:150851307-150851329 CTCCTTTTTTTTGTTTTTGTTGG - Intronic
982002267 4:151031770-151031792 CTCCCTTTTTTTTTTTTTTTTGG - Intergenic
982134637 4:152262531-152262553 CTCGATTTTCTTTTTTTTATTGG - Intergenic
982250028 4:153395875-153395897 CTTGATTTTGTTTTGTTTTTTGG + Intronic
982264660 4:153527262-153527284 CTTCAGTTTTTTTTCTTTGTGGG + Intronic
982318377 4:154055126-154055148 TTCTATTTTCTTTTGTTTCAAGG + Intergenic
982514453 4:156327225-156327247 CTCCGTATTCTTTTCTATGTTGG + Intergenic
982808006 4:159790232-159790254 CTCCAATTTCATTTATTTGCTGG + Intergenic
983091411 4:163507121-163507143 TTCCTTTTTTTCTTGTTTGTGGG - Exonic
983225033 4:165077838-165077860 TTCCGTTTTTTTTTGTTTTTTGG - Exonic
983647125 4:170003367-170003389 CTCCATTTTCTTTTGTTTGTGGG - Intronic
983720324 4:170843359-170843381 TTCCTTTCTCTTTTGTTGGTTGG - Intergenic
983806875 4:172004828-172004850 CCCAATTTTTTTTTGTTTCTTGG + Intronic
984347987 4:178555794-178555816 CTCCTTTTTCTTTTGTCATTTGG + Intergenic
984452276 4:179918196-179918218 CTCAATTATCATTTCTTTGTAGG - Intergenic
984469206 4:180144349-180144371 CAGCCTTTTCTTTTGTGTGTGGG + Intergenic
984953777 4:185025605-185025627 TTTTATTTTCTTTTTTTTGTGGG + Intergenic
985079526 4:186250306-186250328 CTCCAGATGCTTTTGTGTGTCGG + Exonic
985116111 4:186593163-186593185 CTTCAATTTCTTTTTTTTGGGGG - Intronic
985118235 4:186613342-186613364 GTCCATTTGTTTTTGTTTGTAGG - Exonic
985753695 5:1700060-1700082 CTTCATTTTCTGTTCTTTCTGGG + Intergenic
985944780 5:3170689-3170711 CTCCAGTTTCTTCTGTTTTGCGG + Intergenic
986196860 5:5544962-5544984 TTGCTTTTTCTTTTGTTTTTAGG + Intergenic
987185179 5:15410454-15410476 CTATATTTTCTTTTATTTGTTGG - Intergenic
987390807 5:17373753-17373775 TTCTTTTTTCTTTTGTTTGAGGG + Intergenic
987656094 5:20807831-20807853 AACTATTTTCTTTTCTTTGTAGG + Intergenic
987750529 5:22033035-22033057 CCCCATTTTTTTTTTTTTTTTGG - Intronic
988616540 5:32780644-32780666 ATTCATTTTCTTGTTTTTGTTGG + Intronic
988703856 5:33703812-33703834 CTCCATTTTGGTTGGTTTCTTGG - Intronic
989102028 5:37832525-37832547 CCCCATTGTGTTTTGTCTGTGGG - Intronic
989368785 5:40683130-40683152 CTGCTTTTTCTTATGCTTGTTGG + Intronic
989445625 5:41525159-41525181 ATACATTTTCATGTGTTTGTTGG - Intergenic
989741882 5:44783442-44783464 CTCAATTTTCTTATCTATGTAGG - Intergenic
989773568 5:45174181-45174203 ATCCTTTTTCATCTGTTTGTGGG + Intergenic
990048539 5:51465832-51465854 TTCCTTTTTCTTCTGTTTTTTGG + Intergenic
990268257 5:54103538-54103560 CTCCTTTCACTTTTGTTTATTGG - Intronic
990290930 5:54350847-54350869 CTCCATTTAATTTTGTCGGTTGG - Intergenic
990450216 5:55926462-55926484 TTTCATTTTGTTTTGTTTTTTGG - Intergenic
990875377 5:60478375-60478397 CTCCATTTTGTTTTTCTTGGAGG - Intronic
991395502 5:66200356-66200378 CTCCATTTTATCTTCTCTGTTGG + Intergenic
992083553 5:73258141-73258163 CTCCTTTTTTTTTTTTTTTTGGG + Intergenic
992602826 5:78421912-78421934 CTCCTTGTTCATTTGTCTGTTGG + Exonic
992636029 5:78726780-78726802 ATCCATTTTCTGTTGTTTCTTGG + Intronic
992886128 5:81162170-81162192 TTTCTTTTTCTTTTCTTTGTTGG + Intronic
992982812 5:82194272-82194294 CTCCATTTTCTTCTGTTTTATGG + Intronic
993118110 5:83741823-83741845 CTCCATTTTCCTTTGCTTCCTGG - Intergenic
993301652 5:86219205-86219227 CTCCATTTTCTTTATCTTGCTGG - Intergenic
993357426 5:86931608-86931630 TTCCATTTTTTTTTTTTTTTTGG - Intergenic
993694633 5:91046622-91046644 CTGCATTTGCTTTTGGTTCTTGG - Intronic
993826267 5:92690839-92690861 CTCCATTTTCATTTTATTTTTGG + Intergenic
993886369 5:93420196-93420218 ATACAATTTTTTTTGTTTGTTGG - Intergenic
994286249 5:97971883-97971905 TCCAATTTGCTTTTGTTTGTTGG + Intergenic
994311097 5:98271715-98271737 TTCCATTTTCATTTGTTTCTAGG - Intergenic
994558270 5:101332024-101332046 ATCCATTTTTTTTTTTTTTTTGG - Intergenic
994977368 5:106827421-106827443 TTCCATTTTCTTCTGTTTGATGG - Intergenic
995239663 5:109871580-109871602 CTCCATTTTCTTTGGGTTGGGGG - Intergenic
995295714 5:110519241-110519263 CTACATTCTGTTTTGATTGTTGG - Intronic
995838253 5:116419819-116419841 CTCCATCTTTGTTTGTATGTAGG + Intergenic
996044962 5:118861795-118861817 GTCCATTTTATTTTCTTTTTGGG - Intronic
996357290 5:122610576-122610598 CTCCATTATGGTTTGTCTGTTGG + Intergenic
996800482 5:127397409-127397431 CTCCACTGTCTTTATTTTGTTGG + Intronic
996890618 5:128414803-128414825 CTACTTTTTTTTTTGCTTGTAGG + Intronic
996906175 5:128603282-128603304 TTCCATTTTCATTTGTTTCAAGG + Intronic
997382523 5:133447929-133447951 CTCCTTTTTTTTTTCTTTCTTGG + Intronic
997455117 5:134010965-134010987 TTCCCTTTTTTTTTTTTTGTAGG + Intergenic
997708849 5:135986084-135986106 CTCCACTTTCTGATGTTTGCTGG + Intergenic
997759950 5:136435774-136435796 CTGCATTTTATTTTGTTTTTTGG + Intergenic
997997803 5:138600495-138600517 CACCATTTGTTTTTGTGTGTGGG - Intergenic
998344028 5:141445289-141445311 TTCCATTCTCTTCAGTTTGTAGG + Intronic
998583785 5:143404916-143404938 CTGTATTTTGTTTTATTTGTAGG - Intronic
998769508 5:145525916-145525938 ATCCATTTTCTTTTCTTTCTGGG + Intronic
999534784 5:152504467-152504489 GTCCATTTTTTTTTTTTTTTTGG + Intergenic
999642474 5:153685832-153685854 CACCATTTTCTTTCCTTTGCAGG + Intronic
999998246 5:157112816-157112838 GTCCATTTTTGTTTGTTGGTTGG - Intronic
1000635183 5:163635906-163635928 CTACATTTTCCTTTTTTTGGAGG + Intergenic
1001360619 5:171082297-171082319 AGCCATTTTCTTGTGTTTCTGGG + Intronic
1001741574 5:174057247-174057269 CTCCATTTTCTTTTAACTGCGGG + Intronic
1001775143 5:174323191-174323213 CTGCATTTTTTTTTTTTTTTTGG - Intergenic
1001824412 5:174733776-174733798 CTGCTTTTTATTTAGTTTGTAGG - Intergenic
1002256176 5:177959803-177959825 CTCCTTTTTTTTTTTTTTTTGGG + Intergenic
1002537517 5:179885590-179885612 CTCCATCTTTTTTTTTTTGGGGG - Intronic
1004057794 6:12158606-12158628 CACCATTTTCTTAGGTTTCTGGG + Intronic
1004067408 6:12262280-12262302 CTGCATTTTCTGTCTTTTGTTGG - Intergenic
1004489193 6:16098055-16098077 CTCCATGTTGTTTTCTTTCTTGG - Intergenic
1005044498 6:21629019-21629041 CTCCAATTTTTTTTTTTTTTTGG - Intergenic
1005410212 6:25537261-25537283 CTCAATTTGTTTTTGTTTTTTGG + Intronic
1005520279 6:26595193-26595215 CTTCATTTTTTTTTTTTTGTCGG + Intergenic
1006250870 6:32782723-32782745 CTCCAATCTCTTCTGCTTGTAGG - Intergenic
1006476209 6:34256124-34256146 ATCCACTTTATTTTCTTTGTTGG - Intergenic
1007233128 6:40365087-40365109 CTCCATGTTCTTTTCTTTGTTGG - Intergenic
1008165292 6:48130478-48130500 CTCCATTCTACTTTGTTTCTAGG + Intergenic
1008178958 6:48303840-48303862 CTCCATTTTCCTTTCTCAGTAGG - Intergenic
1008643080 6:53484641-53484663 GTCAAATTTCTTTTGTTTCTGGG + Intergenic
1008757816 6:54818456-54818478 TTCTTTTTTCTTTTTTTTGTGGG - Intergenic
1008840839 6:55902021-55902043 TTCCATTTTATTTTTTATGTAGG - Intergenic
1009043013 6:58204109-58204131 ATCCTTTTGCTTTTGTATGTAGG + Intergenic
1009218848 6:60958361-60958383 ATCCTTTTGCTTTTGTATGTAGG + Intergenic
1009464972 6:63957231-63957253 TTACATTTTCTGTTTTTTGTTGG - Intronic
1009484429 6:64202184-64202206 CTCCATGTGCTTTCCTTTGTTGG + Intronic
1009549571 6:65070521-65070543 TTTAATTTTTTTTTGTTTGTGGG + Intronic
1009820999 6:68801057-68801079 CTCCATTGGCCTATGTTTGTAGG + Intronic
1010333296 6:74649671-74649693 TTCCATTTTCATTTGTTTCAAGG - Intergenic
1010793450 6:80091756-80091778 CTCCATTTTCTTGTTCTTATTGG + Intergenic
1011376911 6:86697327-86697349 GTTCATTTTCTTTTTGTTGTGGG - Intergenic
1011928469 6:92677684-92677706 CTCCTTTTTTTTTTTTTTTTTGG - Intergenic
1012194913 6:96329555-96329577 CACCAGTTTCTTAAGTTTGTTGG - Intergenic
1012300689 6:97584041-97584063 CACAACTTCCTTTTGTTTGTAGG + Intergenic
1012522835 6:100141125-100141147 CAGCATTTTCTTTTTTTTTTTGG - Intergenic
1012780780 6:103554523-103554545 CTTCATTTTTTTTTTTTTTTTGG + Intergenic
1012921450 6:105224513-105224535 CTAAATTTTGTTTTGTTTTTTGG + Intergenic
1013500388 6:110743641-110743663 CTTCATTCTTTTTTTTTTGTAGG - Intronic
1013607026 6:111759982-111760004 CTTCATTTTTTTTTTTTTCTGGG + Intronic
1014655833 6:124102539-124102561 AGGCATTTTCTTATGTTTGTTGG + Intronic
1014682515 6:124449456-124449478 CTCTATTTTGTGTTGTGTGTAGG - Intronic
1014735890 6:125095925-125095947 TTCCAGTTTCTGGTGTTTGTTGG - Intergenic
1014741333 6:125151038-125151060 CTGCATTTTTTTTTTTTTGATGG + Intronic
1014785232 6:125611245-125611267 CTCCTTTTTCTTTCTTTTTTTGG + Intergenic
1014864776 6:126515297-126515319 CTCTATTTTTTTTTTTTTGAGGG + Intergenic
1014930837 6:127333941-127333963 CCCCATTTTCTTATGCTTATTGG + Intronic
1015281288 6:131436816-131436838 CTCTATTTTCATTTGTTTCAAGG - Intergenic
1015356586 6:132284419-132284441 TTCCATTTTATTTCCTTTGTTGG - Intergenic
1015651342 6:135464488-135464510 ATCCCCTTTCTTTTGTGTGTGGG + Intronic
1015668409 6:135658392-135658414 CTGCATTTCCTTTTGTTTCCTGG + Intergenic
1016011093 6:139137628-139137650 CTCCTTTTTTTTTTTTTTTTTGG + Intronic
1016164088 6:140917926-140917948 CTGCCTTTTCTTTTGTTCCTAGG - Intergenic
1016226486 6:141745357-141745379 CACCAATTTATTATGTTTGTTGG - Intergenic
1016663590 6:146609772-146609794 CTCCAATTTCTTCTGGTTATAGG + Intronic
1017091958 6:150767194-150767216 CTCCATTTGTTTTTCTTTTTTGG + Intronic
1017393094 6:153962697-153962719 CTCATTTTTCTCTTGTTTGAGGG + Intergenic
1017608186 6:156155445-156155467 CTCCTTTTGTTTTTGTTTTTTGG - Intergenic
1017744417 6:157434118-157434140 CTCTATTTTCTTTTTGTTGTTGG - Intronic
1018422773 6:163653715-163653737 CTTGATTATCTATTGTTTGTTGG - Intergenic
1018612274 6:165658115-165658137 CGCCATTAACTTCTGTTTGTGGG - Intronic
1019408031 7:894096-894118 CTCAGTTTACTTTTGTTAGTAGG + Intronic
1019839078 7:3421089-3421111 CTCCTTTTTTTTTTTTTTGGTGG + Intronic
1021093124 7:16506265-16506287 CTTCATTTTCTATTGTCAGTGGG - Intronic
1021261133 7:18458917-18458939 ATCCTTTTTCTTTGGTTTCTTGG + Intronic
1021565595 7:22013520-22013542 CTCCATTTACTTTTCATTCTTGG - Intergenic
1021586149 7:22210793-22210815 CTCCATTTTTTTTTAAATGTAGG + Intronic
1021878834 7:25074225-25074247 CTCGATTTTTTTTTTTTTTTTGG - Intergenic
1022093552 7:27123834-27123856 GTCCTTTTCCTTTGGTTTGTGGG - Intronic
1022171102 7:27832512-27832534 CTCAATTTTATTTTGTTTTGGGG + Exonic
1022650263 7:32267533-32267555 CTGCATTTTCTGTAGTTTGAGGG - Intronic
1022893024 7:34720273-34720295 CTCCCTTTTTTTTTTTTTCTCGG - Intronic
1023369399 7:39497994-39498016 CCCCATTTTCTCATGTTTGGTGG + Intergenic
1023371203 7:39513780-39513802 CTTCTTTTTTTTTTTTTTGTGGG - Intergenic
1023520354 7:41044403-41044425 ATCCATTATATTTTGTTTCTTGG + Intergenic
1024515338 7:50248068-50248090 CTCCTCTTTCTTTTCTTTCTTGG - Intergenic
1024582527 7:50811502-50811524 CTCCATTTTCTTCTATTTTTGGG - Intergenic
1026581163 7:71618573-71618595 CACCATTTTTTCATGTTTGTTGG + Intronic
1026615687 7:71901425-71901447 CTCTATTTTTTTTTTTTTTTTGG - Intronic
1026942832 7:74297583-74297605 CTGCCTGTTCCTTTGTTTGTGGG + Intronic
1027614426 7:80403791-80403813 CTCCTTTTTTTTTTCTTTATAGG - Intronic
1028024817 7:85823830-85823852 CTATATTTTCTTTTGTTTCTGGG - Intergenic
1028094036 7:86738237-86738259 CTCCATTTTCTGTTCTTTCTGGG - Intronic
1028142212 7:87286986-87287008 CTCCACTCTCTTTGGTTTGTAGG + Intergenic
1028150767 7:87368683-87368705 TTCCATTTTCTTTTCTTAGAAGG + Intronic
1028174462 7:87637700-87637722 TTTCATTTTCTTGTGGTTGTTGG + Intronic
1028223645 7:88224592-88224614 CTCCACTTTCTTAAGATTGTTGG + Intronic
1028413183 7:90552933-90552955 CTCTCTTTTTTTTTTTTTGTTGG + Intronic
1028415436 7:90575242-90575264 CTCCATTTGGTTTGGTCTGTTGG - Intronic
1028486514 7:91364253-91364275 TTTCATTCTCTTTTCTTTGTTGG - Intergenic
1029885446 7:103865229-103865251 CTCAATTTTCTTTTCATTATTGG - Intronic
1029933120 7:104394698-104394720 CGTCATTTTCTTTTTTTTTTTGG + Intronic
1030125163 7:106146296-106146318 CTCGATTTTTTTTTTTTTTTTGG + Intergenic
1030559975 7:111072900-111072922 CTCCTTTTTTTTTTTTTTTTTGG - Intronic
1030589248 7:111460356-111460378 CTCTATTTTCTTTTAGTTCTTGG - Intronic
1030859535 7:114607634-114607656 GTGCATTTTCTTTGGATTGTGGG - Intronic
1030881301 7:114882940-114882962 CACCATTTTCTTTGGCTTCTTGG + Intergenic
1030974232 7:116101193-116101215 TTCCTTTTTCTTTTTTTTGGGGG - Intronic
1031069806 7:117149725-117149747 CTCCTTTTTCTTTTTTTAATTGG + Intronic
1031126581 7:117780320-117780342 CTTTATTTTGTTTTGCTTGTAGG - Intronic
1031131829 7:117841948-117841970 CTGCTTTTTCTTTTGTCTCTAGG - Intronic
1031696600 7:124863700-124863722 TTCCAGTTTCTTTGGTTCGTAGG - Intronic
1031802503 7:126265449-126265471 CTCCCTTAGCTTTTGTTTATAGG - Intergenic
1031822456 7:126521262-126521284 ATGTATTTTCTTTTGTCTGTTGG - Intronic
1031892371 7:127309680-127309702 CTCCATTGTCATTTGTTTCAAGG - Intergenic
1032870826 7:135982795-135982817 TCCCATTTTTTTTTCTTTGTGGG - Intergenic
1033169630 7:139072187-139072209 CTGCATTATCTTTTTTTTTTTGG + Intronic
1033849479 7:145478143-145478165 CTACATTTTTTTTTTTTTTTTGG - Intergenic
1034537329 7:151733701-151733723 CACCATTTTTTTTTTTTTGAGGG + Intronic
1034850515 7:154489114-154489136 CCCCTTTTTCTCTTGTTTATGGG + Intronic
1036102667 8:5803878-5803900 CTTCTTTGACTTTTGTTTGTTGG - Intergenic
1036120861 8:6016207-6016229 TTTCATTTTTTTTTTTTTGTGGG - Intergenic
1036272395 8:7319231-7319253 CTCTTTTTTTTTTTTTTTGTTGG - Intergenic
1037207359 8:16339216-16339238 CACCATTTTATTTTCTTTTTTGG + Intronic
1037262261 8:17022448-17022470 CTCCATTTTTTTTTTTTTCTAGG - Intergenic
1037286191 8:17303028-17303050 CTCCAGTTGCTTTTTTGTGTAGG - Intronic
1037431206 8:18815291-18815313 CTTCAAATTCTTTTTTTTGTGGG + Intronic
1037560066 8:20065641-20065663 CTCCATTTTCTTTTCTTTCATGG - Intergenic
1038030909 8:23638334-23638356 CTCCATCTTTTTTTTTTTTTTGG - Intergenic
1038188610 8:25298171-25298193 GTCAATTTTCTTTGGTTTGTTGG + Intronic
1038272125 8:26083577-26083599 CTTCTTCTTCTTTTGTTTTTTGG - Intergenic
1038811793 8:30854258-30854280 CTCCTTTTTTTTTTTTTTTTTGG - Intronic
1039173454 8:34776205-34776227 TTCCATTTTCATTTGTTTCAAGG - Intergenic
1039581944 8:38674174-38674196 ATCCTTTTTTTTTTTTTTGTAGG - Intergenic
1039670253 8:39588200-39588222 CACCTTTTGCTTTTGTTTGTGGG + Intronic
1039732043 8:40290543-40290565 TTCCTTTTTATTTTGGTTGTGGG + Intergenic
1039926878 8:41942297-41942319 CTCCATTTCATTTTGTTGTTGGG + Intronic
1040388692 8:46932075-46932097 CTTTATTTTCTTTAATTTGTAGG - Intergenic
1040597780 8:48856711-48856733 CTTCATTTTATTTTCTTTTTTGG + Intergenic
1040732049 8:50459741-50459763 CTACATGTTCTTTTGTAAGTGGG - Intronic
1041429884 8:57767334-57767356 CACCTTTTTTTTTTTTTTGTGGG - Intergenic
1041471890 8:58219732-58219754 CTCCATTTTATTTTTTTTAAAGG - Intergenic
1041956709 8:63564307-63564329 CCCCATTTTCTTTTGTTCCTAGG + Intergenic
1042836767 8:73086157-73086179 CTCCCTTTTCTTTTTTTTTTTGG + Intronic
1043703478 8:83320810-83320832 ATCCATATTTTTTTGTTTCTTGG - Intergenic
1043753573 8:83971813-83971835 ATCCATTCTCTTTTTTATGTGGG - Intergenic
1043961409 8:86423059-86423081 CTTCATTTTTTTTTTTTTTTTGG + Intronic
1044227238 8:89733274-89733296 CTCCATCTTTTTTTATTTTTTGG - Intergenic
1044567910 8:93684993-93685015 CTCCAATGTCTTTTTTTTTTTGG - Intergenic
1045280138 8:100742887-100742909 CTTCTTCTTCTTTTTTTTGTGGG - Intergenic
1045303405 8:100934683-100934705 CTCCTTACTCTTTTGTTTTTTGG - Intronic
1045724218 8:105152174-105152196 CTCCATTTCCTTTTCTTCCTGGG - Intronic
1045913650 8:107440380-107440402 ATCCAATTTCTTTAGTTTATAGG + Intronic
1046467645 8:114627347-114627369 TTCCTTTTTCTTTTTTTTCTTGG - Intergenic
1046746480 8:117881724-117881746 CTACATTTTCTTTTCTTTTTAGG - Intronic
1046931638 8:119847323-119847345 CTACTTTTTCTTTTGTTGTTTGG - Intronic
1047638663 8:126794840-126794862 CTGCATTTGCCTGTGTTTGTTGG - Intergenic
1047970170 8:130077698-130077720 CTACTTTTTGTTTTGTTGGTTGG - Intronic
1048220553 8:132537237-132537259 CTCCATAATCCTCTGTTTGTCGG - Intergenic
1048225743 8:132583628-132583650 CTTCATTGTCATTTGTTGGTTGG - Intronic
1048543237 8:135362248-135362270 TGCCATTTCCTTTTGTTTCTAGG + Intergenic
1048633623 8:136271644-136271666 TTCCACTTTCTCTTGTTTTTAGG + Intergenic
1049771799 8:144386007-144386029 CCCCTTTTTCTTTTATTTTTTGG + Intronic
1050047777 9:1565996-1566018 CTACATTTTTTTTTTTTTTTGGG + Intergenic
1050096416 9:2072077-2072099 TTTCATTTTGTTTTGTTTTTTGG + Intronic
1050271284 9:3948151-3948173 CTCCAGTTTCTTTTCTTTCAAGG + Intronic
1050438418 9:5633707-5633729 CTCCCTCTTTTTTTGTATGTGGG + Intronic
1050656490 9:7834074-7834096 CTGCCCTTCCTTTTGTTTGTTGG + Intronic
1051045957 9:12873864-12873886 CACCATTTTTTTTTTTTTTTTGG + Intergenic
1052170233 9:25385729-25385751 TTGTATTTTATTTTGTTTGTAGG + Intergenic
1052478212 9:28989209-28989231 TTCATTGTTCTTTTGTTTGTTGG - Intergenic
1052892302 9:33713253-33713275 CCCCATTTTATTTTCTTTGTTGG - Intergenic
1053552029 9:39091735-39091757 CTCCTTTCTCTTTTATTTTTTGG + Intronic
1053816162 9:41911869-41911891 CTCCTTTCTCTTTTATTTTTTGG + Intronic
1054106422 9:61055553-61055575 CTCCTTTCTCTTTTATTTTTTGG + Intergenic
1054614435 9:67275572-67275594 CTCCTTTCTCTTTTATTTTTTGG - Intergenic
1054780694 9:69163637-69163659 CTCAATTTTTTTTTTTTTTTTGG - Intronic
1054912325 9:70465890-70465912 CTCCATGTATTTTTGTATGTAGG - Intergenic
1055197106 9:73609467-73609489 CTTCTTTTACTTTTGTTTATAGG - Intergenic
1055373728 9:75626227-75626249 TTCCTTTTTCTTTTCTCTGTGGG + Intergenic
1055607439 9:77985324-77985346 CTACAAACTCTTTTGTTTGTTGG - Intronic
1055635790 9:78277419-78277441 GTCCAATTTTTGTTGTTTGTAGG - Intronic
1055971620 9:81917796-81917818 TTCCAACATCTTTTGTTTGTTGG - Intergenic
1055973370 9:81932842-81932864 TTCCAACATCTTTTGTTTGTTGG - Intergenic
1055975124 9:81947934-81947956 TTCCAACATCTTTTGTTTGTTGG - Intergenic
1055980157 9:81993160-81993182 TTCCAACATCTTTTGTTTGTTGG - Exonic
1056446135 9:86667709-86667731 TTCCATTTTATTTTGTTCTTGGG - Intergenic
1056673220 9:88649462-88649484 TTCCATTTTATCTTCTTTGTTGG + Intergenic
1056763641 9:89431494-89431516 CTAGATTCTCTTTTGTTTTTTGG + Intronic
1057515789 9:95719281-95719303 CTCCACCTTGTGTTGTTTGTTGG + Intergenic
1057581028 9:96287868-96287890 TTCCATTTTTTTTTTTTTTTTGG - Intronic
1057998385 9:99841229-99841251 CTCCTTTTTTTTTTTTTTTTCGG - Intronic
1058336497 9:103836168-103836190 CTCCCTTTTTTTTTGTAAGTAGG - Intergenic
1058370826 9:104265546-104265568 CCCTGTTTTCTTTTGTGTGTTGG + Intergenic
1059258424 9:112952361-112952383 TTCCATTTTATTTCCTTTGTTGG + Intergenic
1059609076 9:115872343-115872365 CTGCATCGTCTTTTATTTGTGGG + Intergenic
1059783882 9:117559364-117559386 CTGGTTTTGCTTTTGTTTGTGGG + Intergenic
1059880369 9:118682557-118682579 CTACATTTACTTGTGTATGTTGG - Intergenic
1059913473 9:119072914-119072936 CTCAATTTTTGTTTGTTTTTAGG - Intergenic
1059930812 9:119258728-119258750 TTCCATTTTCTTGACTTTGTGGG + Intronic
1059999821 9:119948143-119948165 CTCCATTTTCATTGTTTTTTTGG + Intergenic
1060127711 9:121066005-121066027 CTGCATTTTTTTTTGTTCTTTGG - Intergenic
1060433034 9:123566833-123566855 CTCCAAATACTTTTTTTTGTTGG + Intronic
1060812600 9:126618527-126618549 CTGCTTTTTCTTTTTTTTGAAGG - Intronic
1061015501 9:127979018-127979040 CTCTATTTTTTTTTCTTTTTTGG - Intronic
1061352474 9:130076542-130076564 TTCCATTTTCATTTTTTTTTTGG + Intronic
1061880199 9:133565136-133565158 CTCCCCTTTCTTTTGTTTCAAGG + Intronic
1062514889 9:136927905-136927927 CTCATTTTTCTTCTGGTTGTTGG + Intronic
1185895710 X:3857133-3857155 CTACATTTTCTTTTGCTGGAAGG - Intergenic
1185900829 X:3895557-3895579 CTACATTTTCTTTTGCTGGAAGG - Intergenic
1185905944 X:3933996-3934018 CTACATTTTCTTTTGCTGGAAGG - Intergenic
1185910920 X:3980511-3980533 GTCTAATTTCTTTTTTTTGTAGG + Intergenic
1186285507 X:8039672-8039694 TTCCTTTTTTTTTTTTTTGTGGG + Intergenic
1186648112 X:11528920-11528942 ATCCATTTTCTTTTATTTCTGGG - Intronic
1186673409 X:11790639-11790661 CTCTATTTTCTCTTTTTTCTGGG + Intergenic
1187118477 X:16379702-16379724 CTCCATATGCTTTTTTTAGTTGG - Intergenic
1188013387 X:25081324-25081346 CTGCATTTTTTTTTCTTTTTTGG + Intergenic
1188535123 X:31188582-31188604 CTGGGTTTTGTTTTGTTTGTTGG + Intronic
1188716133 X:33461763-33461785 TTCCATTTTCATTTGTTTCAAGG + Intergenic
1188952703 X:36396045-36396067 TTTCATTTTGTTTTTTTTGTTGG + Intergenic
1189597420 X:42584177-42584199 CTCCATTGTCTTTTGTCAATAGG + Intergenic
1189768852 X:44401699-44401721 ATCTATTTTTTTTTGTTTTTAGG - Intergenic
1189873861 X:45413960-45413982 CTCCCTTTTCCTTTATTTTTTGG + Intergenic
1189895451 X:45651002-45651024 CTACATTTTCTTGTGTGTATGGG - Intergenic
1189991386 X:46598458-46598480 CTTCATATTCCTTTGTATGTAGG - Intergenic
1190138748 X:47821642-47821664 CTCCATTTTTATTTCATTGTGGG - Intergenic
1190190137 X:48270176-48270198 CTCCATGTTTTTTTGATTATGGG + Intronic
1190200185 X:48354746-48354768 TTCCTTTTTTTTTTTTTTGTAGG - Exonic
1190658883 X:52636653-52636675 CTCCATGTTTTTTTGATTCTGGG + Intergenic
1190666995 X:52705242-52705264 TTCCTTTTTTTTTTTTTTGTAGG - Exonic
1190672423 X:52753166-52753188 TTCCTTTTTTTTTTTTTTGTAGG + Exonic
1190989786 X:55535535-55535557 GACCATTTTCTTGTGTTTCTTGG + Intergenic
1191017101 X:55820395-55820417 ATCTTTTTTCATTTGTTTGTTGG + Intergenic
1191173331 X:57472599-57472621 GTTCCTGTTCTTTTGTTTGTTGG + Intronic
1191178298 X:57530669-57530691 TTCCATTTTCTTTTGTCTCAAGG + Intergenic
1191181763 X:57571534-57571556 CTTCTTTTTTTTTTCTTTGTTGG - Intergenic
1191628648 X:63297664-63297686 GTCCATTTTCTTTTTTTTTCAGG + Intergenic
1191730389 X:64328436-64328458 CTCATTTTTCTTTTCTTTGTTGG + Intronic
1191819471 X:65287609-65287631 TTCCATTTTCATTTGTTTCAAGG - Intergenic
1192315264 X:70046403-70046425 CTCAATTTTTTTTTTTTTTTTGG + Intronic
1193095256 X:77541330-77541352 CTGGACTTCCTTTTGTTTGTGGG - Intronic
1193279966 X:79635942-79635964 ATCTATTTTGATTTGTTTGTTGG + Intergenic
1193510703 X:82395915-82395937 TTCCATTTTTTTTTTTTTGATGG + Intergenic
1193709077 X:84857332-84857354 TGCCTTTTTGTTTTGTTTGTTGG - Intergenic
1193710462 X:84873098-84873120 TGCCTTTTTGTTTTGTTTGTTGG + Intergenic
1194026730 X:88762324-88762346 ATACATTTTCTGTTGTTTTTGGG + Intergenic
1194157634 X:90412527-90412549 CTTGATATTCTTTTTTTTGTTGG + Intergenic
1194183279 X:90739069-90739091 CTCCAATCTCTTCTGGTTGTAGG - Intergenic
1194602289 X:95937013-95937035 CTCCCTTTGCCTTTGTTTCTGGG + Intergenic
1194685922 X:96915402-96915424 TTGCATTTTCTTTTTTTTTTTGG + Intronic
1194974200 X:100376911-100376933 CTCCACTTTCTGTTGCTTGTGGG + Intronic
1195254712 X:103080616-103080638 GTCCATTTTGTTTTGATTTTCGG - Intronic
1195266965 X:103190982-103191004 CCCCATTTTCTTTTATTTGAAGG - Intergenic
1195528116 X:105917875-105917897 CTGAATTTTCTTCTTTTTGTTGG + Intronic
1195907014 X:109853965-109853987 CTCTTTTTTTTTTTTTTTGTGGG - Intergenic
1196064611 X:111449345-111449367 TTCCCTTTTCTTCTGTTTCTTGG - Intergenic
1196117894 X:112016863-112016885 CTTCATTATCTTTTGTTTACAGG - Intronic
1196802874 X:119559212-119559234 CTCCGTTTTTTTTTTTTTGACGG - Intronic
1197116833 X:122843694-122843716 CTCCATATTTTTTTGCTTTTAGG + Intergenic
1197593719 X:128441411-128441433 CTCCATCTTCTTGGTTTTGTTGG - Intergenic
1197961830 X:132015414-132015436 CCTCATTTTCTTTTGAGTGTAGG + Intergenic
1198191552 X:134311887-134311909 CTCCACTTTCTTTAGCTTTTTGG - Intergenic
1198256751 X:134930864-134930886 CTCCTTTTTTTTTTTTTTTTAGG + Intergenic
1198374006 X:136019571-136019593 TTACATTTTCTTTTCTTTTTAGG + Intronic
1198424203 X:136497994-136498016 CTTCTTTTTGTTGTGTTTGTTGG + Intronic
1198425353 X:136513890-136513912 CCCCATTTTCTTTTGATGATAGG - Intergenic
1198571596 X:137963179-137963201 CTCAACTTTTTTTTGTTGGTAGG - Intergenic
1199363445 X:146949336-146949358 TTTCATTTTGTTTTGTTTTTTGG - Intergenic
1199610919 X:149612781-149612803 ATCCAGTTTCTTGTGGTTGTAGG + Intronic
1200513112 Y:4104999-4105021 ATCCATTTATTTTTCTTTGTGGG + Intergenic
1200529895 Y:4321024-4321046 CTCCAATCTCTTCTGGTTGTAGG - Intergenic
1200631187 Y:5590083-5590105 CTCCATTTTTTTTTTTTTTTTGG - Intronic
1200964641 Y:9024991-9025013 CTTCATTTTTTTTTTTTTGCAGG + Intergenic
1201420299 Y:13791350-13791372 ATGCATTTTCATTTCTTTGTAGG + Intergenic
1201644401 Y:16213163-16213185 CTCACTTTTTTTTTGTTGGTAGG - Intergenic
1201658414 Y:16372158-16372180 CTCACTTTTTTTTTGTTGGTAGG + Intergenic
1201919970 Y:19223634-19223656 CTACATTTTATTTTATTTGTAGG + Intergenic