ID: 983647128

View in Genome Browser
Species Human (GRCh38)
Location 4:170003403-170003425
Sequence ATTGAGGGCATTGAACTAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 79}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983647128_983647134 -2 Left 983647128 4:170003403-170003425 CCAACTAGTTCAATGCCCTCAAT 0: 1
1: 0
2: 1
3: 7
4: 79
Right 983647134 4:170003424-170003446 ATACACAGATGAAGGAGGGACGG 0: 1
1: 1
2: 5
3: 71
4: 736
983647128_983647133 -6 Left 983647128 4:170003403-170003425 CCAACTAGTTCAATGCCCTCAAT 0: 1
1: 0
2: 1
3: 7
4: 79
Right 983647133 4:170003420-170003442 CTCAATACACAGATGAAGGAGGG 0: 1
1: 0
2: 1
3: 21
4: 228
983647128_983647129 -10 Left 983647128 4:170003403-170003425 CCAACTAGTTCAATGCCCTCAAT 0: 1
1: 0
2: 1
3: 7
4: 79
Right 983647129 4:170003416-170003438 TGCCCTCAATACACAGATGAAGG 0: 1
1: 0
2: 2
3: 11
4: 197
983647128_983647132 -7 Left 983647128 4:170003403-170003425 CCAACTAGTTCAATGCCCTCAAT 0: 1
1: 0
2: 1
3: 7
4: 79
Right 983647132 4:170003419-170003441 CCTCAATACACAGATGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983647128 Original CRISPR ATTGAGGGCATTGAACTAGT TGG (reversed) Intronic
905505000 1:38471501-38471523 CTTGAGGGAACTGACCTAGTTGG - Intergenic
911700894 1:100950748-100950770 AGTGAGTGCTTTTAACTAGTCGG - Intronic
923143544 1:231182021-231182043 AATGAGGGCCTTGCTCTAGTAGG + Intronic
1064158617 10:12924303-12924325 ATGGAGGGCATTGCACTGGTAGG + Intronic
1069690521 10:70348755-70348777 ATTGAGGGCTCTGAACTTGAAGG - Intronic
1072741853 10:97914585-97914607 TCTGAGGACATTGAACTAGCAGG - Intronic
1076911589 10:133392727-133392749 CTTGGGGGCATTGACCTAGCAGG + Intronic
1084010106 11:66343187-66343209 ATTGAGGACATCGAACAAGTGGG - Intronic
1087966303 11:104420807-104420829 ATTGAGGTAAATGAAGTAGTTGG + Intergenic
1088410006 11:109523690-109523712 ATTGTGGGCATTGAAGTAAAGGG - Intergenic
1102164807 12:110797675-110797697 AATGAGGGCATTGAAATAAAAGG - Intergenic
1102622413 12:114206689-114206711 TTTGAGAACATTGACCTAGTGGG - Intergenic
1103015776 12:117493544-117493566 ATTGGGGGGAGTGACCTAGTTGG - Intronic
1106210753 13:27642246-27642268 ATTGAGGACTTTGATCTACTAGG - Intronic
1106447536 13:29850163-29850185 CTCAAGGGCATTTAACTAGTTGG + Exonic
1106542718 13:30704386-30704408 AATGAGGGAATTGAACTTGGTGG + Intergenic
1106793847 13:33184034-33184056 TTTTGGGGCACTGAACTAGTCGG + Intronic
1107110285 13:36690184-36690206 ATTGAGAACATTGAATTAGAGGG - Intronic
1107163360 13:37256958-37256980 ATTGAGGGCTTTTAACTATGAGG + Intergenic
1109470015 13:62791811-62791833 AGTGAGGCCATAGAACTGGTTGG + Intergenic
1110876251 13:80514036-80514058 TTTAATGGCATGGAACTAGTGGG - Intergenic
1111897341 13:94157658-94157680 ATAGAGGGCATTGAAGGACTTGG + Intronic
1116826651 14:49679171-49679193 ATTGATGGCATTTAACTGGAAGG - Intronic
1120807553 14:88769126-88769148 GGTGAGGGCATTGATATAGTTGG + Intronic
1131530781 15:93189984-93190006 AGTCAGGGCAGTGAGCTAGTGGG + Intergenic
1139085922 16:63585395-63585417 ATTAAAGGCATTAAACAAGTGGG + Intergenic
1140721013 16:77772268-77772290 ATTGGGGGCATTGAGTTAATAGG - Intergenic
1144998580 17:19287944-19287966 ATTGAGGCCATGGAACAAGATGG - Intronic
1148198046 17:45728872-45728894 ATGGAGGGCATTGAAGGAGGAGG + Intergenic
1149282280 17:55120854-55120876 TCTGAGGGCATGGAACTTGTAGG - Intronic
1155429780 18:25743171-25743193 AATGAGGGAATTGAACAAGGTGG + Intergenic
1156021787 18:32607814-32607836 AATAAGGGCAGAGAACTAGTTGG + Intergenic
1156540451 18:37904513-37904535 TTTGAGGGCAAAGAACTAGAAGG - Intergenic
1159123981 18:64201653-64201675 AATGAGGGCCTGGAACTGGTGGG + Intergenic
1159778998 18:72639588-72639610 ATTTAGGGCTTTGGACTAGTTGG + Intergenic
1160053915 18:75461949-75461971 ATTGAGGTCATTGAGAAAGTAGG + Intergenic
937558906 2:123195698-123195720 ATTTAGGGCATGTAACTAATAGG - Intergenic
938684447 2:133723853-133723875 ATCGAGGGCAGTGGACAAGTAGG + Intergenic
939646137 2:144701203-144701225 ATAGAGGGCAATGAACTATCAGG + Intergenic
940218184 2:151322579-151322601 ATTTAGGGAGTTGAATTAGTAGG + Intergenic
942583483 2:177447698-177447720 ATTTAGGGAAATGAACTAGTAGG - Intronic
943838492 2:192546871-192546893 ATTGAGGTCATTTAAATTGTTGG - Intergenic
945808938 2:214524473-214524495 AATGAGGGGATTAAACTAGAAGG + Intronic
1172532330 20:35641183-35641205 ATTGAGGGACTTGAATTAGATGG - Intronic
1176657180 21:9597558-9597580 ATGGAAGGCATTCTACTAGTTGG - Intergenic
949956527 3:9273726-9273748 ATTGAAGTCTTTGAACTATTTGG + Intronic
951586094 3:24216246-24216268 TTTCATGGCATTGAACTAGATGG + Intronic
953031920 3:39185150-39185172 GTTGAGGGCATTGAGCTTGGGGG + Exonic
960985779 3:123279742-123279764 AATGAGGGCATTGGAGTAGCTGG - Intergenic
966031316 3:175351753-175351775 AAAGATGGCAATGAACTAGTTGG + Intronic
966348779 3:179006909-179006931 ATTGAAGGCATAAAACTAATTGG + Intergenic
970943403 4:21661731-21661753 ATCGAGGGCAGTGAACTAGATGG - Intronic
971132222 4:23825018-23825040 ATTGTGGGCATTGATCCAGATGG + Intronic
974581229 4:63804481-63804503 ATTTTGGGCATAGAAGTAGTTGG + Intergenic
977960723 4:103082042-103082064 ATTGAGGGTAATGAACTCCTTGG + Intronic
978251360 4:106634745-106634767 TCTCTGGGCATTGAACTAGTTGG + Intergenic
979405741 4:120308893-120308915 AATAATGGCATTGAACTAATAGG + Intergenic
983647128 4:170003403-170003425 ATTGAGGGCATTGAACTAGTTGG - Intronic
984505747 4:180616173-180616195 CCTGAGGGAAGTGAACTAGTTGG - Intergenic
984506154 4:180621569-180621591 ATTGAGGGCATTGAACATTTAGG - Intergenic
985418246 4:189758571-189758593 ATGGAAGGCATTCTACTAGTTGG + Intergenic
988349474 5:30083750-30083772 ATTTAAGGCACTGAACTTGTGGG + Intergenic
1018937313 6:168282260-168282282 ATGTAGGGCATTGAAGTACTGGG - Intergenic
1020114972 7:5471156-5471178 ATTGCGGGCGTTGAACTTGCAGG - Intronic
1021114700 7:16734315-16734337 AGTGAGGGCAGTGGACAAGTGGG + Intergenic
1021623356 7:22569524-22569546 AGTGATAGCATTGAAGTAGTGGG + Intronic
1022095166 7:27135972-27135994 ATTGAGGTCATTCAACCACTAGG + Intronic
1026398362 7:69982942-69982964 ATTGATGGGATTGAACTAAATGG - Intronic
1026609292 7:71843291-71843313 AATGAGTGCATTGATGTAGTTGG - Intronic
1032940394 7:136782041-136782063 ACTGAAGGCATTCAACTAGAAGG - Intergenic
1034919573 7:155069011-155069033 CTTGAGGTCATGGAACTAATGGG - Exonic
1036664139 8:10727960-10727982 ATTAAGGGCATTGTACCAATTGG + Intronic
1038136963 8:24796775-24796797 ATTGAAGGCCTTGAACAATTGGG + Intergenic
1041036001 8:53791377-53791399 ACTCTGGGCATAGAACTAGTGGG - Intronic
1044975274 8:97658479-97658501 ATAAATGGCATTGAACTTGTTGG + Intronic
1045985918 8:108249629-108249651 ATTTAGGGCATTGGTCTAGATGG - Intronic
1051324805 9:15953936-15953958 ATCGAGGGCATTCAATTTGTCGG + Intronic
1051618486 9:19029176-19029198 TTTGAGGACATTGTACTTGTTGG - Intronic
1052670945 9:31556449-31556471 CTTAAGGGCTTTGAACTGGTTGG + Intergenic
1055593893 9:77846330-77846352 ATTGATGGCATTGAAGCAGGCGG - Intronic
1056293589 9:85169215-85169237 ATTCATCGCATTGAACTAGGAGG - Intergenic
1061367482 9:130179813-130179835 AATGAGGGCATTGAACTACTTGG - Intronic
1203634902 Un_KI270750v1:101132-101154 ATGGAAGGCATTCTACTAGTTGG - Intergenic
1189143524 X:38631934-38631956 ATTGAAAGCATTGTCCTAGTGGG - Intronic
1192637620 X:72834302-72834324 CTTCAGGGCATTGTTCTAGTAGG + Intronic
1192644094 X:72886513-72886535 CTTCAGGGCATTGTTCTAGTAGG - Intronic
1193793089 X:85840805-85840827 ACTGATGGCATTGAGCTAGTGGG - Intergenic
1200304565 X:155010902-155010924 ATTGAGGTCATTGATCCACTTGG - Intronic