ID: 983647133

View in Genome Browser
Species Human (GRCh38)
Location 4:170003420-170003442
Sequence CTCAATACACAGATGAAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 228}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983647127_983647133 7 Left 983647127 4:170003390-170003412 CCAAATATAACTACCAACTAGTT 0: 1
1: 0
2: 1
3: 13
4: 147
Right 983647133 4:170003420-170003442 CTCAATACACAGATGAAGGAGGG 0: 1
1: 0
2: 1
3: 21
4: 228
983647126_983647133 29 Left 983647126 4:170003368-170003390 CCACAAACAAAAGAAAATGGAGC 0: 1
1: 1
2: 2
3: 74
4: 691
Right 983647133 4:170003420-170003442 CTCAATACACAGATGAAGGAGGG 0: 1
1: 0
2: 1
3: 21
4: 228
983647125_983647133 30 Left 983647125 4:170003367-170003389 CCCACAAACAAAAGAAAATGGAG 0: 2
1: 0
2: 3
3: 93
4: 926
Right 983647133 4:170003420-170003442 CTCAATACACAGATGAAGGAGGG 0: 1
1: 0
2: 1
3: 21
4: 228
983647128_983647133 -6 Left 983647128 4:170003403-170003425 CCAACTAGTTCAATGCCCTCAAT 0: 1
1: 0
2: 1
3: 7
4: 79
Right 983647133 4:170003420-170003442 CTCAATACACAGATGAAGGAGGG 0: 1
1: 0
2: 1
3: 21
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983647133 Original CRISPR CTCAATACACAGATGAAGGA GGG Intronic
908158675 1:61384483-61384505 CATAATACACAAATGAAAGAAGG - Intronic
908439348 1:64137962-64137984 CTCATTTCACAGATGAAGAAGGG - Intronic
910265241 1:85331576-85331598 CTCAATACACTCTTGATGGATGG - Intronic
910545206 1:88408106-88408128 ATTTTTACACAGATGAAGGAGGG + Intergenic
910772671 1:90845593-90845615 TTAAATACACAGAGGAAAGAAGG + Intergenic
911436983 1:97872981-97873003 CTGAAAATAAAGATGAAGGAGGG - Intronic
911482538 1:98461909-98461931 TTCAGTACACAGACGATGGATGG - Intergenic
913486972 1:119340591-119340613 CACAAAACACAGATAAAGGTAGG - Intergenic
918178124 1:182062796-182062818 CTTAATACCTAGGTGAAGGAAGG - Intergenic
919468261 1:197948316-197948338 CCCAAAACAAAGATGCAGGAAGG + Intergenic
920165721 1:204034429-204034451 CTCAATAAAAAAAAGAAGGAAGG - Intergenic
920681692 1:208077864-208077886 CTCTCTGCACAGATGAATGAGGG + Intronic
921134395 1:212247313-212247335 CACAATACACAGAAGAATGCTGG - Intergenic
921648285 1:217646163-217646185 TTCAAGACAGAAATGAAGGATGG - Intronic
922059239 1:222071921-222071943 CTCAATACAGAGGTGTGGGAAGG + Intergenic
922364127 1:224847985-224848007 CTCAATTCAGATATGAAGAAAGG - Intergenic
1063006447 10:1975484-1975506 TTCCATACACAGATGCAGGAAGG + Intergenic
1063022560 10:2144290-2144312 CCCAACACACACATGAAGAAGGG + Intergenic
1063953437 10:11244892-11244914 CACCAGACACAGATGGAGGAAGG - Intronic
1064727555 10:18296928-18296950 CTCATTTTACAGATGAATGACGG - Intronic
1064749139 10:18508369-18508391 CTGAATCCACAGAGGAAGGGAGG + Intronic
1064977389 10:21132745-21132767 GTCAATAAACACATGAAAGAAGG - Intronic
1065764676 10:29016908-29016930 CTCAAGACACAGATGTACTAAGG - Intergenic
1068893130 10:62169159-62169181 CTCAATACACTGATCCAGGGAGG + Intergenic
1070616866 10:77975965-77975987 CTCAATTCAAAGATAAAGGGGGG + Exonic
1071262866 10:83936763-83936785 CTCATTACACAGATGAGGGAAGG + Intergenic
1072773767 10:98168084-98168106 CTCAATACACATCTGGAGGTTGG - Intronic
1073036426 10:100567097-100567119 CTCAATACACATATAAAATAGGG + Intergenic
1073719150 10:106146267-106146289 CTCAAGACTATGATGAAGGAAGG + Intergenic
1074050572 10:109877673-109877695 CTCAACAGACAGATGAAGGTGGG + Intronic
1074163176 10:110851145-110851167 CTCAAACCACAGAAGAAGGGCGG - Intergenic
1074363434 10:112840018-112840040 CTGGATACACAAATGGAGGAGGG + Intergenic
1076541781 10:131219503-131219525 CTCAATACATACTTGCAGGAGGG + Intronic
1079008589 11:16810273-16810295 TTCAAGATCCAGATGAAGGAAGG - Intronic
1082808214 11:57463182-57463204 CCCAATTTGCAGATGAAGGAAGG - Intronic
1084208093 11:67607546-67607568 CTTAACACACAGGTGATGGAGGG - Intronic
1085670526 11:78460081-78460103 CTGAAGACACAGAAGAAGGGTGG + Intronic
1087388394 11:97503597-97503619 CTCAACAGACAGATGAAGAGGGG + Intergenic
1087406526 11:97737880-97737902 CTCATTACACACATGAAAAATGG - Intergenic
1088358467 11:108967367-108967389 GGCAATACAGAGATGGAGGATGG + Intergenic
1090268704 11:125370924-125370946 CTAGAACCACAGATGAAGGAAGG + Intronic
1092548437 12:9471664-9471686 CTCATGACACGGATGAAGAAAGG + Intergenic
1094504570 12:31050785-31050807 CTCATGACACAGATGAAGAAAGG - Intergenic
1095690484 12:45082948-45082970 GTCAATACACAGAAGCATGAAGG + Intergenic
1097240035 12:57568866-57568888 CTCAGTCCACGGAGGAAGGAAGG - Intronic
1098364099 12:69684263-69684285 CTGATTAGAAAGATGAAGGAGGG - Intronic
1098445698 12:70563718-70563740 CTCAATACACAGCTGAACTCTGG + Intronic
1098579901 12:72087386-72087408 CTGAAGACACAGAAGAAAGATGG + Intronic
1100010578 12:89947922-89947944 CACACTCTACAGATGAAGGAAGG + Intergenic
1100108578 12:91208818-91208840 ATTAATATACATATGAAGGAAGG - Intergenic
1100203359 12:92323101-92323123 CTCAATACATTTATGAAGGTTGG - Intergenic
1102595671 12:113990864-113990886 CTAAATACACATATGGGGGAGGG + Intergenic
1103323346 12:120104121-120104143 CTCCACACACAAGTGAAGGAGGG + Intronic
1103915100 12:124372136-124372158 CTCAAGGCAGAGAAGAAGGAGGG - Exonic
1105287204 13:19014083-19014105 CTCACTCCACACATGCAGGAAGG + Intergenic
1106590088 13:31091494-31091516 CTCACTTCACAGATGAGGGTTGG - Intergenic
1106625844 13:31420319-31420341 CTGGATACACACAGGAAGGAAGG + Intergenic
1107033923 13:35881024-35881046 CTGAATATACAGATGAACAATGG + Intronic
1107126453 13:36851477-36851499 GCCAAAACACAGAAGAAGGATGG - Intronic
1107681826 13:42859718-42859740 ATCATTACACAGATGCAGGAAGG - Intergenic
1108505970 13:51112714-51112736 ATCAATTCACAGATGAAGAAGGG + Intergenic
1113984555 13:114303452-114303474 CTGTATACACAGATGGAGCATGG - Intronic
1114938074 14:27570176-27570198 ATCAAAACACATATAAAGGAAGG + Intergenic
1116429322 14:44827752-44827774 CTCCATTCACATATGAAGCAAGG - Intergenic
1119921191 14:78447822-78447844 CCCATTTCACAGATGAAGAAAGG - Intronic
1122015486 14:98791795-98791817 ATCAATACACAGAGGAGGGCTGG + Intergenic
1122600531 14:102919473-102919495 ATCAACAGACAGATGACGGATGG - Intergenic
1123500235 15:20875366-20875388 CTCACCACACACATGAAAGAGGG - Intergenic
1123557481 15:21449060-21449082 CTCACCACACACATGAAAGAGGG - Intergenic
1123593708 15:21886322-21886344 CTCACCACACACATGAAAGAGGG - Intergenic
1123785020 15:23662976-23662998 CCCAGTGGACAGATGAAGGAAGG + Intergenic
1124160338 15:27262518-27262540 CTCAATACTCAGATGGGGTAGGG - Intronic
1124665132 15:31585865-31585887 ATCAATAGAGAGAGGAAGGAGGG + Intronic
1124956396 15:34363307-34363329 CTCAGTCCTCAGATGAAGAAGGG + Intronic
1127750458 15:62035832-62035854 CTCATGACACAGATGAACTATGG + Intronic
1128759993 15:70210074-70210096 ATAAATAGACTGATGAAGGAGGG + Intergenic
1129147512 15:73662271-73662293 CAAAATTAACAGATGAAGGATGG - Intergenic
1129359413 15:75015242-75015264 CTGAATAAACAAAGGAAGGAGGG - Intronic
1132075733 15:98818335-98818357 CTCAATACACAGTGGAAGTTGGG + Intronic
1202965830 15_KI270727v1_random:176233-176255 CTCACCACACACATGAAAGAGGG - Intergenic
1133551234 16:6856173-6856195 CTCAATACACATTTGAAGAAGGG - Intronic
1137495374 16:48965313-48965335 CTGTGTAGACAGATGAAGGAGGG + Intergenic
1138154065 16:54686171-54686193 CTCAATAAAAAGAAAAAGGAAGG - Intergenic
1148543230 17:48496750-48496772 GACAATACACAGCTGAGGGAAGG - Intergenic
1149514692 17:57271601-57271623 GTAAAAACCCAGATGAAGGAAGG - Intronic
1150804930 17:68311236-68311258 CCCATCACACAGATGAAGGGAGG - Intronic
1151977063 17:77489073-77489095 CCCAAGACGCAGCTGAAGGATGG - Intronic
1155944276 18:31830124-31830146 CTCTATACTGAGATGAATGAGGG + Exonic
1156277917 18:35602377-35602399 ATAAATACACAGATACAGGAAGG - Intronic
1157511174 18:48275987-48276009 CTCAAGATACAGAGGGAGGAGGG + Intronic
1158325643 18:56311535-56311557 CCCATTTCACAGATGAAGAAAGG + Intergenic
1161308435 19:3579821-3579843 GTCAATCCACAGAGGCAGGAAGG - Intergenic
1161452555 19:4354557-4354579 CTCAATAAATGTATGAAGGAGGG + Intronic
1163680915 19:18682006-18682028 CTCAAAACAAAGATAAAGTAGGG + Intergenic
1164016796 19:21261048-21261070 CTCACTTCCCAGATGATGGACGG + Intronic
1164317097 19:24100494-24100516 ATGAATACATAGTTGAAGGAAGG - Intronic
1164781063 19:30893253-30893275 CTGAAAACACAGATGGAGAATGG + Intergenic
1167602307 19:50461461-50461483 CACAAGACACAGACGAAAGAAGG - Intronic
926428009 2:12757347-12757369 ATAAATACACAAAGGAAGGAAGG - Intergenic
927147120 2:20173537-20173559 CTCAATAAGCAAATGAATGAAGG + Intergenic
928697061 2:33859994-33860016 CACAATACACAGCCGCAGGAGGG - Intergenic
929037193 2:37705598-37705620 CTTAATAGACAGATAAATGAAGG - Intronic
929505891 2:42527745-42527767 CTCAAGACACTGAGGTAGGAGGG + Intronic
936540113 2:113342825-113342847 CACATTACAAAGAGGAAGGACGG - Intergenic
937483191 2:122284963-122284985 CTCAATAAACAGAAGAGGAAAGG - Intergenic
937783905 2:125873105-125873127 CACACAACACAGATGAATGAGGG + Intergenic
937845153 2:126571541-126571563 CTCATTTTACAGATGAAGCACGG + Intergenic
939008967 2:136822534-136822556 CCCATTTTACAGATGAAGGAAGG + Intronic
940015634 2:149101327-149101349 CTCAATACAGGGATGCAGAAGGG - Intronic
940032288 2:149276412-149276434 AACAATACAAAGATGAAGAAGGG + Intergenic
940071596 2:149694464-149694486 CTAAATATAGAGGTGAAGGAAGG + Intergenic
940148192 2:150570112-150570134 CTCAATACACAATGCAAGGAGGG + Intergenic
940765248 2:157783264-157783286 CTAAGTACACAGATGCAGGAAGG + Intronic
941902490 2:170691715-170691737 CTCATTAAACAGATGATGAATGG - Intergenic
942922240 2:181389577-181389599 CTGAAGAAACAGATGCAGGAAGG - Intergenic
944112289 2:196145487-196145509 CTCAAGACAAAAATGAATGAAGG + Intronic
945584795 2:211647118-211647140 CTCAATAAAATAATGAAGGAGGG + Intronic
945985678 2:216351761-216351783 CTCATCTCAAAGATGAAGGAAGG + Intronic
946605068 2:221394963-221394985 CTCCACACACAGATGCAGGGAGG - Intergenic
947615487 2:231554470-231554492 CTGAGTACACAGACGAAGGAAGG - Intergenic
1171804071 20:29658669-29658691 CCCAAGACACAGAAGAAGGCAGG + Intergenic
1171839982 20:30197751-30197773 CCCAATACATAGAAGAAGGCAGG - Intergenic
1173564063 20:44026822-44026844 CTCACCCCACAGAAGAAGGAAGG - Intronic
1174269896 20:49360290-49360312 CTCTGTACACAGATTAAAGAGGG + Intergenic
1174338827 20:49883400-49883422 CACAACACACAGATGAGGGATGG - Intronic
1175063089 20:56261558-56261580 TTCACTACGCAGATGAAGCAGGG - Intergenic
1175432467 20:58915657-58915679 CTAAAAAGACAGAAGAAGGAAGG - Intergenic
1175538917 20:59736140-59736162 CTCAGTCCTCAGATGATGGATGG - Intronic
1175604026 20:60297847-60297869 CTGTAAACACAGATGAAGCATGG + Intergenic
1176185448 20:63775881-63775903 CTCTATGCACAGGTGGAGGAGGG - Exonic
1176668484 21:9709608-9709630 ATCAAGACGCAGAGGAAGGAAGG + Intergenic
1176878607 21:14164296-14164318 CTCATTACATGGAAGAAGGATGG + Intronic
1178448121 21:32663930-32663952 GTCTATACACAGATGATGAAGGG + Intronic
1182638829 22:31750721-31750743 CTCAATGGACATTTGAAGGAAGG + Intergenic
1185157564 22:49203356-49203378 CTCAAGATGCAGAGGAAGGAAGG + Intergenic
951043215 3:18011088-18011110 CTCTATTAACTGATGAAGGAAGG - Intronic
951661446 3:25071011-25071033 CTCAAGACTCAGAAGAAGCATGG - Intergenic
952056785 3:29456826-29456848 GACAATACACAGGTGAAGAAAGG + Intronic
953502762 3:43454082-43454104 CTCAATAAAGACCTGAAGGAAGG + Intronic
954034089 3:47841173-47841195 CTCAAGGTACAGATGGAGGATGG + Exonic
956696287 3:71921897-71921919 CTGAATACACATAGGAAGGTGGG - Intergenic
956710624 3:72035613-72035635 CTGATTGCACAGATGAAGGAAGG - Intergenic
959553382 3:107689633-107689655 CTAAATACACTGAGGAGGGAGGG - Intronic
959937208 3:112041492-112041514 CTCAATAAACATTTGAGGGAAGG - Intronic
960625321 3:119676852-119676874 CTCAACACACATTTGTAGGAAGG + Intronic
961630861 3:128297353-128297375 CTCAATCCACAAATAAAGAAAGG - Intronic
962747710 3:138409842-138409864 CTCATGAATCAGATGAAGGAAGG - Intergenic
966651529 3:182306213-182306235 CTCAACACTCATAGGAAGGATGG + Intergenic
971529679 4:27670842-27670864 CCCAATACACAGATGAGGCATGG - Intergenic
972777155 4:42252006-42252028 CTTATTATACAGATGCAGGACGG + Intergenic
973589345 4:52424996-52425018 CTTAAAACCCAGATGAAGGGTGG - Intergenic
974207341 4:58723096-58723118 CTCAATACACAAAAGAAACAAGG + Intergenic
974273946 4:59690530-59690552 TCCATTACACAGATGATGGAAGG + Intergenic
974424803 4:61727556-61727578 CTCATTACAGAGAGGAGGGAAGG + Intronic
974427644 4:61760801-61760823 CTCAATATACAGATCTTGGAGGG - Intronic
975735093 4:77373068-77373090 CTCAATCCCCAGAGTAAGGAGGG + Intronic
977036375 4:91958589-91958611 CTCTATACACAAATCAAGGAAGG - Intergenic
978313698 4:107413792-107413814 CTCTGTGCACAGATCAAGGAAGG + Intergenic
980779430 4:137478287-137478309 CTTAAAACAGAGATTAAGGAAGG - Intergenic
983630695 4:169846333-169846355 ATAAATACAAAGATGAATGAGGG - Intergenic
983647133 4:170003420-170003442 CTCAATACACAGATGAAGGAGGG + Intronic
985406295 4:189641900-189641922 ATCAAGACGCAGAGGAAGGAAGG - Intergenic
985729017 5:1536112-1536134 CTCAATATAAAGAAGAAAGAGGG - Intergenic
985819869 5:2152331-2152353 CTCATTGCACAGATGGAAGATGG + Intergenic
985819872 5:2152366-2152388 CTCATTGCACAGATGGAAGATGG + Intergenic
985819875 5:2152401-2152423 CTCATTGCACAGATGGAAGATGG + Intergenic
985819878 5:2152436-2152458 CTCACTGCACAGATGGAAGATGG + Intergenic
985819881 5:2152471-2152493 CTCACTGCACAGATGGAAGATGG + Intergenic
985819884 5:2152506-2152528 CTCACTGCACAGATGGAAGATGG + Intergenic
985819887 5:2152541-2152563 CTCACTGCACAGATGGAAGATGG + Intergenic
985819890 5:2152576-2152598 CTCACTGCACAGATGGAAGATGG + Intergenic
987146829 5:14999560-14999582 CTCAATTCACAGTAGCAGGATGG + Intergenic
987150106 5:15029775-15029797 CTCAATACAGGTAGGAAGGAGGG + Intergenic
988602395 5:32652000-32652022 TTCATTTCACAGATGAAAGAGGG - Intergenic
990452768 5:55951504-55951526 CAGCATACACAGATGAAGGTGGG - Exonic
991426390 5:66496601-66496623 CTCCATACACAGAGGTAGGGAGG + Intergenic
992085316 5:73273138-73273160 CTGAATCCACAGATGGAGGAGGG - Intergenic
994344540 5:98669012-98669034 CTCCATCCACTGAGGAAGGATGG - Intergenic
994806781 5:104458494-104458516 CTCAAGAAACAGATAAATGATGG - Intergenic
995762613 5:115579335-115579357 TTCATTTCACAGATAAAGGAGGG + Exonic
996294542 5:121896105-121896127 CTCAAAACACAGATAAGGGAAGG + Intergenic
996328677 5:122306087-122306109 ATCAATACTCTGATGAAGGAGGG + Intergenic
997626403 5:135334094-135334116 CCCGTTCCACAGATGAAGGAGGG - Exonic
1001832970 5:174805080-174805102 GTGAAGACACAGATGCAGGAGGG - Intergenic
1001946259 5:175780770-175780792 CTCAGAACACAGAGAAAGGATGG - Intergenic
1002937810 6:1688325-1688347 CCCATTACACAGATGAACGACGG + Intronic
1003563909 6:7206437-7206459 CTGAATGGACAAATGAAGGAAGG - Intronic
1003859605 6:10310252-10310274 CTCATTACACAGTTGTTGGAAGG - Intergenic
1004276276 6:14238128-14238150 CTCCACACACAGATGAAGAGGGG - Intergenic
1004314665 6:14575402-14575424 CACATTTCACAGATGAAGAAAGG + Intergenic
1004929383 6:20447127-20447149 CTCTGAACACAGAGGAAGGAGGG + Intronic
1006929425 6:37678738-37678760 CTCAGAAGACAGCTGAAGGAAGG - Intronic
1008028318 6:46664212-46664234 CTCTATAGATAGATGAAGAATGG - Intronic
1009585546 6:65597267-65597289 CTCAATGCTCAAATGAAGGTAGG - Intronic
1010106388 6:72174117-72174139 CTCAAATCACAGATGGAGGAGGG - Intronic
1014107416 6:117582737-117582759 TTCAATTCATGGATGAAGGATGG + Intronic
1014110559 6:117616080-117616102 CTCCATGCACAGACCAAGGAAGG + Intergenic
1014909415 6:127072366-127072388 CTTAATGCACACATGAAAGAAGG + Intergenic
1015451372 6:133370933-133370955 CTCAGTACACATCTAAAGGAAGG - Intronic
1016501019 6:144720778-144720800 ATAAATACACAGAGGAGGGAGGG - Intronic
1016800004 6:148158737-148158759 CTCAACATACATAGGAAGGAAGG + Intergenic
1019345576 7:528580-528602 ATGAATAGACAGATGATGGATGG + Intergenic
1019345607 7:528802-528824 ATGAATAGACAGATGATGGATGG + Intergenic
1020713845 7:11644078-11644100 CACAATACACAAAAGAATGAAGG - Intronic
1020799665 7:12718113-12718135 CTCAAAAAAAAGAAGAAGGAAGG - Intergenic
1021910601 7:25382510-25382532 CCCAATACACAGCTGTTGGAGGG + Intergenic
1022760144 7:33339910-33339932 TCCAATACACAGAGGGAGGAGGG + Intronic
1024062402 7:45708886-45708908 CTCACGACACAGGTGAGGGAAGG - Intronic
1024086842 7:45900382-45900404 AACAGTACCCAGATGAAGGAGGG - Intergenic
1024242291 7:47445006-47445028 CCCAATACAGAGGTTAAGGAAGG - Intronic
1026185957 7:68082590-68082612 CTCACTTCCCAGATGAAGGGCGG - Intergenic
1030207074 7:106961426-106961448 CTCAATGGACATATGAAGAAGGG + Intergenic
1030777381 7:113551380-113551402 CTTAATACACAGTTAAATGATGG - Intergenic
1033913338 7:146291574-146291596 TTCAATAAACAGCTGAAGGCAGG + Intronic
1035659047 8:1333198-1333220 CACATTACAGAGATGGAGGAAGG + Intergenic
1038043768 8:23749020-23749042 TTAAATACACAAATGCAGGAGGG + Intergenic
1038051053 8:23811881-23811903 ATTAATACACAGATGTTGGATGG + Intergenic
1039923714 8:41910567-41910589 GTCAGCACACGGATGAAGGATGG - Intergenic
1041116164 8:54539627-54539649 CTCTATTAACAGATGGAGGAAGG - Intergenic
1042088416 8:65132777-65132799 CTCTGTGCACAGATCAAGGAAGG - Intergenic
1044687700 8:94843657-94843679 CTGTATACACATATGATGGAGGG + Intronic
1045756064 8:105543736-105543758 TTGAATACACAAAAGAAGGAAGG - Intronic
1046916293 8:119681452-119681474 GTTATTACACAAATGAAGGAAGG + Intergenic
1047533736 8:125700261-125700283 TTCCAAACACAGATGGAGGAAGG + Intergenic
1047954530 8:129963382-129963404 GGCTATACACAGATGAAGCAAGG + Intronic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1048979665 8:139696619-139696641 CTGAGTACACAGAGGAGGGAGGG + Intronic
1049030668 8:140035042-140035064 CTGTATACACAGCTGGAGGAGGG + Intronic
1050771470 9:9206663-9206685 CACAAAAGACAGATGAAGGCAGG - Intronic
1051746545 9:20300075-20300097 GTAAATACACAGATGATGGTTGG + Intergenic
1052886368 9:33652043-33652065 CTCACTAGACAGGGGAAGGAGGG - Intergenic
1052986108 9:34489396-34489418 CCAAAGACTCAGATGAAGGACGG + Exonic
1053165189 9:35839517-35839539 CACGTTACACAGTTGAAGGAAGG + Intronic
1055251689 9:74315307-74315329 CTCAGTTCACATCTGAAGGAAGG - Intergenic
1056584968 9:87921832-87921854 CTGAGTACACAGCTCAAGGAAGG - Intergenic
1058551190 9:106116662-106116684 CCCATTGCACAGATGAAGGATGG + Intergenic
1060682991 9:125582273-125582295 CTCACCAAACAGATGAAGGAAGG - Intronic
1061403634 9:130382058-130382080 CTCATTTCACAGATGAGGCAGGG + Intronic
1062092567 9:134686074-134686096 CTCAACACAGACATGCAGGATGG - Intronic
1203657382 Un_KI270753v1:11337-11359 ATCAAGACGCAGAGGAAGGAAGG - Intergenic
1186822281 X:13302813-13302835 ATCAAAACACAGATCCAGGAAGG - Intergenic
1187536144 X:20143029-20143051 TTCAATACACACAGAAAGGAAGG + Intergenic
1190301708 X:49060839-49060861 CACAATACACAGATGGGGAAGGG + Intronic
1190969397 X:55334199-55334221 CTCTATACAGAGATCCAGGAAGG + Intergenic
1191670577 X:63745018-63745040 CACAATTCACAGAGGGAGGAGGG + Intronic
1194700440 X:97107324-97107346 TTCAATTCACAGATTAAGTATGG + Intronic
1196872627 X:120127198-120127220 CTCAAGACAGAGATCCAGGAAGG - Intergenic
1198528887 X:137529653-137529675 CTGCATACTCATATGAAGGAAGG - Intergenic
1198585249 X:138113537-138113559 ATGAATACACAAATGAAAGAAGG + Intergenic
1199538017 X:148925695-148925717 CCCATTACACAGATGAGGGAAGG - Intronic
1201366628 Y:13213507-13213529 CACAATAAACAGATGTAGGCCGG - Intergenic