ID: 983647633

View in Genome Browser
Species Human (GRCh38)
Location 4:170007831-170007853
Sequence CTCCCCTGTGGTATTTAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 90}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983647633_983647636 -5 Left 983647633 4:170007831-170007853 CCTGGCTAAATACCACAGGGGAG 0: 1
1: 0
2: 1
3: 7
4: 90
Right 983647636 4:170007849-170007871 GGGAGAATCAGAGACAAGGCAGG 0: 1
1: 0
2: 2
3: 32
4: 418
983647633_983647642 23 Left 983647633 4:170007831-170007853 CCTGGCTAAATACCACAGGGGAG 0: 1
1: 0
2: 1
3: 7
4: 90
Right 983647642 4:170007877-170007899 AGATGGGTTCTAATAAATATGGG No data
983647633_983647643 26 Left 983647633 4:170007831-170007853 CCTGGCTAAATACCACAGGGGAG 0: 1
1: 0
2: 1
3: 7
4: 90
Right 983647643 4:170007880-170007902 TGGGTTCTAATAAATATGGGTGG 0: 1
1: 0
2: 0
3: 9
4: 130
983647633_983647640 7 Left 983647633 4:170007831-170007853 CCTGGCTAAATACCACAGGGGAG 0: 1
1: 0
2: 1
3: 7
4: 90
Right 983647640 4:170007861-170007883 GACAAGGCAGGTTGGGAGATGGG 0: 1
1: 0
2: 2
3: 18
4: 286
983647633_983647635 -9 Left 983647633 4:170007831-170007853 CCTGGCTAAATACCACAGGGGAG 0: 1
1: 0
2: 1
3: 7
4: 90
Right 983647635 4:170007845-170007867 ACAGGGGAGAATCAGAGACAAGG 0: 1
1: 1
2: 4
3: 47
4: 484
983647633_983647639 6 Left 983647633 4:170007831-170007853 CCTGGCTAAATACCACAGGGGAG 0: 1
1: 0
2: 1
3: 7
4: 90
Right 983647639 4:170007860-170007882 AGACAAGGCAGGTTGGGAGATGG 0: 1
1: 1
2: 8
3: 49
4: 494
983647633_983647641 22 Left 983647633 4:170007831-170007853 CCTGGCTAAATACCACAGGGGAG 0: 1
1: 0
2: 1
3: 7
4: 90
Right 983647641 4:170007876-170007898 GAGATGGGTTCTAATAAATATGG 0: 1
1: 0
2: 0
3: 10
4: 112
983647633_983647637 -1 Left 983647633 4:170007831-170007853 CCTGGCTAAATACCACAGGGGAG 0: 1
1: 0
2: 1
3: 7
4: 90
Right 983647637 4:170007853-170007875 GAATCAGAGACAAGGCAGGTTGG 0: 1
1: 0
2: 2
3: 28
4: 360
983647633_983647638 0 Left 983647633 4:170007831-170007853 CCTGGCTAAATACCACAGGGGAG 0: 1
1: 0
2: 1
3: 7
4: 90
Right 983647638 4:170007854-170007876 AATCAGAGACAAGGCAGGTTGGG 0: 1
1: 0
2: 0
3: 22
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983647633 Original CRISPR CTCCCCTGTGGTATTTAGCC AGG (reversed) Intronic
902391676 1:16110824-16110846 CAACCCTGTGGTCTTCAGCCAGG - Intergenic
906027927 1:42690747-42690769 CTACCCTGTGCCATTTAGACTGG + Intronic
907619393 1:55961129-55961151 CTCCCCTGTGCTGTGGAGCCAGG + Intergenic
924650906 1:245926443-245926465 TTTCCCTGTGGTACTTAGCAAGG - Intronic
1066804265 10:39228313-39228335 CTCCCTTCTGGTTTTTATCCTGG - Intergenic
1070627813 10:78063617-78063639 CTCCCCTGTGGGAGGTGGCCTGG + Intergenic
1071110505 10:82149997-82150019 CTCCGCTGTGGTTTATAGGCAGG + Intronic
1072755191 10:98015902-98015924 CTTCACTGTAGTATATAGCCTGG - Intronic
1074050914 10:109880756-109880778 CTCCTCTGTGGCATTGAGCCTGG - Intronic
1074103986 10:110375282-110375304 TTCCCCTGTGGGATGTAGACTGG - Intergenic
1074110472 10:110419217-110419239 CTCCCATGTGCTATTTAACAAGG + Intergenic
1078822334 11:14894579-14894601 CTCTCCTCTGCTATGTAGCCAGG - Intergenic
1082577168 11:54821833-54821855 CTTCCTTCTGGTATTTATCCTGG - Intergenic
1082590822 11:55007222-55007244 CTTCCCTGTAGTTTTTATCCTGG + Intergenic
1082594789 11:55064223-55064245 CTTCCTTGTAGTTTTTAGCCTGG - Intergenic
1085983855 11:81760159-81760181 CATGCCTGTGGTATTTAACCAGG - Intergenic
1087571090 11:99928517-99928539 CTTCCATGTGGTGTTGAGCCTGG - Intronic
1089096353 11:115923090-115923112 CTCCCCGGTGGCAATTAGCCGGG + Intergenic
1091833450 12:3567423-3567445 CACCCATTTGGTATTGAGCCTGG + Intronic
1092744925 12:11664476-11664498 CTCCCCTGTGGTTCGTATCCTGG - Intronic
1106320306 13:28631423-28631445 CTCACCTGTGGTATTCTGCTTGG - Intergenic
1109327441 13:60885379-60885401 CTCCCCTGTGTTATTCATCCAGG - Intergenic
1114141996 14:19922783-19922805 CTCCCCTGTGATCTTAACCCTGG + Intergenic
1114917346 14:27285442-27285464 CTTCCATGTAGTATTAAGCCTGG + Intergenic
1115878937 14:37892981-37893003 CTCCACTGTGTTATCTTGCCAGG + Intronic
1119895727 14:78218482-78218504 CTACCCTGTGGCATCTGGCCAGG - Intergenic
1120051106 14:79867305-79867327 CCAGCCTGTGGTATTTTGCCAGG - Intronic
1128473639 15:67977890-67977912 CTCCATTTTGGTTTTTAGCCTGG + Intergenic
1129392119 15:75225805-75225827 CTCCCATGGGGTGTTCAGCCTGG - Intergenic
1129472261 15:75762359-75762381 CTCCCATGGGGTGTTCAGCCTGG + Intergenic
1137476459 16:48813711-48813733 TTCCACTGTGGGTTTTAGCCTGG + Intergenic
1140710974 16:77677282-77677304 TTCGCCTGAGGCATTTAGCCCGG - Intergenic
1143222814 17:5276656-5276678 CACCCTTGTTGTCTTTAGCCAGG - Intergenic
1144678484 17:17176932-17176954 CTCCCTTGTGGGCTTCAGCCTGG - Intronic
1148667521 17:49386020-49386042 CTCCACTGTGTAATTTAACCAGG + Intronic
1149127595 17:53254561-53254583 CTCCCCTGTGCCACTTTGCCAGG + Intergenic
1149268438 17:54952638-54952660 TTCCCCTGAGGTATTTATTCAGG + Intronic
1152246515 17:79187501-79187523 CAGCCCTGGGGTATTTGGCCTGG + Intronic
1156249469 18:35338398-35338420 CTCCCATGTGGTATTTGTCATGG + Intronic
1161769619 19:6224112-6224134 CTGCCCTGTGGTTTTTTGCTGGG - Intronic
1168601382 19:57721530-57721552 TTCCCCCATGGTATTTAGCCAGG + Exonic
925444434 2:3915636-3915658 CTCCCCTGTGGGCTATAGCTTGG + Intergenic
931757007 2:65383426-65383448 ATCCCCTGTGGTATTCAACAGGG + Intronic
937440644 2:121912613-121912635 CCCCCCTATGGTATAGAGCCTGG + Intergenic
942157816 2:173149597-173149619 CCCCCCTGTGCTATTGAGCAAGG - Intronic
944044049 2:195388466-195388488 CTTCCATGTGGTATCGAGCCTGG + Intergenic
947583099 2:231333874-231333896 CTCCCCCATGGCATTTTGCCGGG - Intronic
1169662844 20:7999278-7999300 ATCCCCTGTGGTATTTTGCGAGG + Intronic
1178338607 21:31766227-31766249 CTTCCATGTGGTATTGAGCCTGG + Intergenic
1181503860 22:23337748-23337770 CGGCCCTGGGGTATTTGGCCTGG + Intergenic
954109516 3:48426327-48426349 TTCCCCAGTGGTCTCTAGCCAGG + Intronic
954958706 3:54545841-54545863 CTTCCCTGTGGTCTTTATTCTGG + Intronic
956892095 3:73623411-73623433 CACCCCTGAGGTATTCATCCAGG - Intronic
958018372 3:87968875-87968897 CCCCCCTGTTGTATGCAGCCTGG + Intergenic
960389246 3:117056616-117056638 CTCCCCTTTGCTGTCTAGCCAGG - Intronic
971255922 4:25013296-25013318 CTCCCCTGTAGTCTTTAGAGTGG - Intronic
971562306 4:28095594-28095616 CTCAGCTGTGTTATTAAGCCAGG + Intergenic
972370559 4:38419462-38419484 CTTCCATGTGGTGTTGAGCCTGG - Intergenic
975629022 4:76380964-76380986 CTTCCATGTGGTGTTGAGCCTGG + Intronic
978145409 4:105366143-105366165 CTTCCATGTGGTGTTGAGCCTGG + Intergenic
979794225 4:124825865-124825887 CTTCCATGTGGTACTTAACCAGG - Intergenic
979984554 4:127297196-127297218 CTGCCCTGTGGTAGGTAGCAGGG - Intergenic
982388686 4:154839850-154839872 CACACCTGTGGTAATTAACCTGG + Intergenic
982841902 4:160199014-160199036 TTCCTCTGTGGTTTCTAGCCTGG - Intergenic
983647633 4:170007831-170007853 CTCCCCTGTGGTATTTAGCCAGG - Intronic
985575546 5:671892-671914 CTCCCCCGTGGTACCCAGCCCGG - Intronic
986350074 5:6868984-6869006 CTCCCCTGTGATGCTGAGCCTGG - Intergenic
988162860 5:27543929-27543951 CTTCCATGTGTTATTGAGCCTGG + Intergenic
989851653 5:46220164-46220186 CTCCCTTCTAGTATTTATCCTGG - Intergenic
992471789 5:77064475-77064497 CTACCCTGTGCCATTTAGACTGG - Exonic
994878897 5:105461013-105461035 CTTCCCTGTGGTTTTGGGCCTGG - Intergenic
1000387118 5:160685332-160685354 CTCCCCTGGGGTTTGCAGCCTGG - Intronic
1001925406 5:175632757-175632779 CTCCCCAGTGGAGTTAAGCCAGG + Intergenic
1002274907 5:178097834-178097856 CACACCTGTGGTAATTAGCTGGG + Intergenic
1008493344 6:52108309-52108331 TCTCCCTGTGGTATTCAGCCTGG + Intergenic
1009064517 6:58442475-58442497 CTTCCCTGTAGTTTTTATCCTGG - Intergenic
1019293584 7:262155-262177 CTCCCCTGTGGTTGCTACCCTGG - Intergenic
1021669606 7:23022132-23022154 CTCTTCTGTGGTATATATCCAGG + Intergenic
1021840691 7:24719429-24719451 CTTCCCTCTGGCATCTAGCCTGG - Intronic
1023168879 7:37370903-37370925 CTCTCCTGGGGTATATATCCTGG + Intronic
1026122685 7:67551394-67551416 CTCCCCTGTGGCACTGAGCATGG - Intergenic
1028848433 7:95509320-95509342 CTGGCCTGTGGTATATAGCTGGG - Intronic
1034475821 7:151281307-151281329 CTCTCCTCTGGCATTTGGCCTGG - Intergenic
1036561555 8:9903815-9903837 CTCCCCCGTGTTAATTACCCCGG + Intergenic
1038261582 8:26000773-26000795 CTTCCCTGTGGACATTAGCCAGG + Intronic
1039912218 8:41834523-41834545 CTGCCCTGTGGTCTCCAGCCTGG + Intronic
1043508547 8:80926777-80926799 TGCCCCTGTGGCATTTACCCTGG + Intergenic
1046202184 8:110941718-110941740 CTCTCCTTTAGTATTTAGTCTGG - Intergenic
1048096461 8:131300595-131300617 CTTCCATGTGGTATTAAGCCTGG - Intergenic
1050845742 9:10215641-10215663 CTCCCCTCTGGCATATATCCAGG - Intronic
1058704054 9:107624355-107624377 CTCCCATGTGCACTTTAGCCTGG - Intergenic
1059492420 9:114679964-114679986 CTCACCTGTGATATTAATCCAGG - Intergenic
1060389148 9:123264479-123264501 CTCCCCTGTGGTTTTTAGACTGG - Intronic
1185753446 X:2632826-2632848 CTCCCATGTGGTTTTGTGCCTGG + Intergenic
1189228466 X:39433258-39433280 CTCCCCACTGTTACTTAGCCTGG + Intergenic
1191268784 X:58434337-58434359 CTTCCTTCTGGTTTTTAGCCTGG + Intergenic
1191898965 X:66022002-66022024 CTTCCCTCTGGTATTTAGAGAGG + Exonic
1194541455 X:95177695-95177717 CTTCCATGTGATGTTTAGCCTGG + Intergenic
1200295401 X:154914208-154914230 CTCCCCTGCAGTGTTCAGCCTGG - Intronic