ID: 983648563

View in Genome Browser
Species Human (GRCh38)
Location 4:170016493-170016515
Sequence TAGGTAGAGCATGATGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 145}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983648563 Original CRISPR TAGGTAGAGCATGATGGGGT GGG (reversed) Intronic
900118008 1:1036717-1036739 TAGGAACAGCCTGGTGGGGTTGG - Intronic
902039790 1:13484269-13484291 GAGATGGAGGATGATGGGGTGGG - Intronic
902051197 1:13564898-13564920 TGGGAAGAGCATGGTGGTGTAGG - Intergenic
905543779 1:38781505-38781527 GAGGAGGAGCATGTTGGGGTGGG - Intergenic
907274918 1:53311622-53311644 TAGGGAGAGAGAGATGGGGTGGG - Intronic
910466640 1:87507178-87507200 AAGGCAGATCTTGATGGGGTTGG + Intergenic
912866695 1:113264108-113264130 GAGGTGGAGCAGTATGGGGTGGG - Intergenic
914360162 1:146928168-146928190 TGGGTAGAGCATGCTGGGTGGGG + Intergenic
914493585 1:148171729-148171751 TGGGTAGAGCATGCTGGGTGGGG - Intergenic
915294752 1:154912151-154912173 GTGCTAGAGGATGATGGGGTGGG - Intergenic
917571683 1:176272441-176272463 AAGGCAGAGCCTGAGGGGGTGGG - Intergenic
919983420 1:202656806-202656828 TGGGAAGAGCATAATGTGGTGGG - Intronic
920704167 1:208239830-208239852 TGGGAAGAGTATGCTGGGGTAGG + Intronic
922157809 1:223053626-223053648 GAGGTGGAGCCTGGTGGGGTTGG + Intergenic
922177778 1:223210244-223210266 TGGGTAGTGGATGATGGAGTGGG + Intergenic
922717752 1:227886084-227886106 CAGGAAGAGCAAAATGGGGTGGG + Intergenic
923018341 1:230144126-230144148 GAGGCAGAGCAGGTTGGGGTAGG + Intronic
923268911 1:232337188-232337210 TAGGAACAGCATGAGAGGGTGGG + Intergenic
923615984 1:235537835-235537857 ATAGTTGAGCATGATGGGGTGGG + Intergenic
924279725 1:242424213-242424235 TCAGTAGAGCATAGTGGGGTGGG - Intronic
1063922788 10:10948708-10948730 TAGGTAGAGAATGAAGAGGAAGG - Intergenic
1065441447 10:25756557-25756579 TTGGTAGAGCAGGGTGGGGTGGG - Intergenic
1071204945 10:83263613-83263635 GAGGTAGTGCATGGTGGTGTGGG - Intergenic
1072468464 10:95689916-95689938 TCTGTACAGCATGATGGAGTGGG - Intronic
1073115168 10:101087775-101087797 GGGGTGGAGCATGCTGGGGTGGG + Intergenic
1075029318 10:119011353-119011375 GAGGTCGAGCATGGTGTGGTGGG - Intergenic
1079239304 11:18711309-18711331 TAGATTGAGAATGATGGGATTGG - Intronic
1083663272 11:64261892-64261914 GAGGTGGAGGCTGATGGGGTGGG + Intronic
1084404119 11:68961213-68961235 TAGTTAGGGCAAGAAGGGGTAGG - Intergenic
1086515363 11:87605432-87605454 TAGGTTGAGCTTGATTGGCTTGG - Intergenic
1086928130 11:92663006-92663028 TAGGAAGACTGTGATGGGGTAGG + Intronic
1091829200 12:3537603-3537625 CAGGCAGAGCAGGTTGGGGTGGG - Intronic
1092030277 12:5278157-5278179 CAGGTAGAGCAGGAAGGGATGGG + Intergenic
1095672518 12:44876842-44876864 TAGGTAGAGACTGGTGGGGACGG + Exonic
1096652437 12:53068470-53068492 ATGGAAGAGCAGGATGGGGTGGG + Intronic
1098706933 12:73702835-73702857 TAGGTAGAGCACCAGGGGGAAGG + Intergenic
1100272676 12:93041366-93041388 TAGAGAGAGAGTGATGGGGTTGG - Intergenic
1104747859 12:131221267-131221289 CAGGTAGGGCCGGATGGGGTTGG + Intergenic
1104999020 12:132676716-132676738 GAGGTAGAGCAGGCTGGGGGTGG - Intronic
1116757881 14:48970523-48970545 TAGGTAGGGCATGTTGGAGTAGG - Intergenic
1118889756 14:69899050-69899072 TAGGTGGAGCATGATGGCTAGGG + Intronic
1119033350 14:71209892-71209914 TGGGTATAGGATGGTGGGGTGGG - Intergenic
1120041430 14:79757628-79757650 TAGGTACAGCATGATGCAGTGGG + Intronic
1120508122 14:85378606-85378628 AAGGTAGAAAATGATGGGGTTGG - Intergenic
1123184290 14:106500588-106500610 AAGATAGAGCATGATAGAGTAGG - Intergenic
1127833294 15:62769653-62769675 AGGGTGGAGGATGATGGGGTGGG - Intronic
1128025152 15:64429621-64429643 TAGGTAGTGCATGTTTGGGTGGG - Intronic
1128252788 15:66174624-66174646 CAGGAAGGGCATTATGGGGTTGG - Intronic
1128976876 15:72160816-72160838 AAGGTAGAGGATGAGGAGGTTGG - Exonic
1129264080 15:74384677-74384699 GAGCTAGAGCCAGATGGGGTGGG - Intergenic
1132518082 16:375186-375208 TGGGTAGGGGATGATGAGGTTGG + Exonic
1132788273 16:1670348-1670370 GTGGGAGAGCATGATGGGGGTGG + Intronic
1132873568 16:2125990-2126012 TAGGAAGAGGATGGTGGGGGGGG + Intronic
1132906027 16:2283252-2283274 GAGGAAGAGCAGGATGAGGTAGG + Exonic
1133673910 16:8051638-8051660 GAGGCAGAGAAAGATGGGGTGGG - Intergenic
1134235939 16:12466628-12466650 CAGGTAGATCATGGTGAGGTAGG - Intronic
1138441427 16:57037317-57037339 CAGAGAGAGCATGATGGGGGGGG - Intronic
1140472755 16:75224438-75224460 GAGGAAGAGCATGGTGGGGCTGG - Intronic
1142622145 17:1171988-1172010 TAGATAGAGCCAGATGTGGTCGG - Intronic
1144679532 17:17183631-17183653 TGGGTAGAGCTGGGTGGGGTGGG + Intronic
1146937106 17:36818711-36818733 TGGGCAGAGCATGGTGGGCTGGG + Intergenic
1148708716 17:49660406-49660428 TAGATAGAGAATGTTGGGGTGGG - Intronic
1148773122 17:50078307-50078329 TAGGCACAGCAGGCTGGGGTGGG - Intronic
1153178285 18:2404060-2404082 TATGAAGAGGATGATGGGGATGG + Intergenic
1153559474 18:6357461-6357483 TTGGTAGGGGATGATGGGGGTGG - Intronic
1153716229 18:7851731-7851753 TAGGTAAAGCATGATCGTGCAGG + Intronic
1157483471 18:48070789-48070811 TGGGAAGGGCAGGATGGGGTGGG - Intronic
1157812285 18:50705812-50705834 GAGATAGAGAGTGATGGGGTGGG - Intronic
1158184900 18:54760370-54760392 TAGGTAGAGGATGTAGGGGAGGG + Intronic
1160190874 18:76713195-76713217 TAGGGAGAGCCTGATGGGATAGG + Intergenic
1160220235 18:76971279-76971301 AAAGTAGAGCTTGATGGGGGTGG - Intergenic
1163251934 19:16131222-16131244 TGGGAAGGGTATGATGGGGTGGG + Intronic
1163635512 19:18435448-18435470 TAGGTCCAGCATGATGGGTGCGG + Exonic
1165418473 19:35710287-35710309 TAGGTAGGGCATGATTGGAAGGG - Intronic
1168076983 19:53985986-53986008 GAGGAAGAGCAAGATGGGGAGGG + Exonic
927734533 2:25507438-25507460 TAGGTAGAACAAGCTTGGGTAGG - Intronic
927951746 2:27174977-27174999 TTGGAAGAGCAAGAGGGGGTGGG - Intergenic
928423159 2:31155708-31155730 TAAGTGGAGTATGAAGGGGTGGG - Intergenic
928442257 2:31302312-31302334 TAGCTGGAGCATGGTGGGCTAGG + Intergenic
928730204 2:34223304-34223326 GGGGTAGAGCATGGTGGGGTTGG - Intergenic
929660546 2:43780055-43780077 TAGGAAGAGGCTGATGGAGTAGG + Intronic
931081615 2:58779059-58779081 TAGTTAGTGCATGGTGTGGTTGG + Intergenic
937788225 2:125927889-125927911 GAGGTAGAGCATGCTAGGATTGG - Intergenic
941571907 2:167181149-167181171 TAGGTATATAATGATGGGGTAGG + Intronic
944020898 2:195102868-195102890 TAGGTAGGGCAACCTGGGGTCGG + Intergenic
948231384 2:236351767-236351789 TAGGCAGGGCAGGATGGGGAGGG + Intronic
1169064387 20:2686121-2686143 GAGGTAGAGCAGGGTGCGGTAGG - Intergenic
1170174546 20:13454268-13454290 TCTGTGGAGAATGATGGGGTGGG + Intronic
1174149930 20:48478633-48478655 CATGCAGAGCTTGATGGGGTTGG + Intergenic
1175881501 20:62262091-62262113 TAGGCAGAGGGTGACGGGGTGGG - Intronic
1177854933 21:26390160-26390182 CTGGAAGAGCATGATGAGGTGGG - Intergenic
1181754398 22:25013039-25013061 TGGGTAGAGTGGGATGGGGTTGG + Intronic
1182420279 22:30245541-30245563 GAGATAGAGGATGATGGGGGCGG - Intronic
951154415 3:19332248-19332270 ATGGTAGAGGGTGATGGGGTTGG - Intronic
951752709 3:26055148-26055170 TAGATGGTGCATAATGGGGTAGG + Intergenic
952992334 3:38842572-38842594 AAGGTAGAGCAATAAGGGGTGGG + Intergenic
954720200 3:52554945-52554967 TTGGTAGTGCATGTGGGGGTTGG - Intronic
955132803 3:56187758-56187780 GAGATAGAGAATGATGGGGGAGG + Intronic
960094413 3:113675222-113675244 TAGGTAGAGCATAGTTGAGTTGG + Intronic
961840146 3:129703445-129703467 TAAGTACAGTAAGATGGGGTTGG + Intronic
963455684 3:145543695-145543717 GAGGTAGAACATGGTGGGATGGG + Intergenic
966470389 3:180282479-180282501 AAGGTAGAGCAATATGGGGCTGG + Intergenic
967310298 3:188099801-188099823 TAGGAAGAACATTATGGGTTGGG + Intergenic
969334452 4:6499363-6499385 AAGGGAGAGAAGGATGGGGTGGG - Intronic
972342138 4:38161378-38161400 TTGGCTGAGCATGATGGGGGAGG + Intergenic
972570616 4:40307374-40307396 GAGTTAGAGCAGGATGAGGTTGG + Intergenic
976409737 4:84699730-84699752 TAGGATGACCATAATGGGGTGGG - Intronic
979232084 4:118357529-118357551 GAGGCAGAGCATGATGGGGAGGG - Intergenic
980126072 4:128775644-128775666 TAGCTAGAGAATGAGGGGATAGG + Intergenic
980172019 4:129301301-129301323 TATGTAGTGCATGGTGGGGGAGG - Intergenic
981803735 4:148688427-148688449 AAGGTAGACCAGGATGGTGTGGG - Intergenic
982665230 4:158252881-158252903 TAAGTGGAGCAAGATGAGGTTGG - Intronic
983525395 4:168755483-168755505 TACATAGGGCATGATGGGGAAGG + Intronic
983648563 4:170016493-170016515 TAGGTAGAGCATGATGGGGTGGG - Intronic
987052567 5:14160196-14160218 CACGTAGAGCAGGTTGGGGTTGG + Intronic
987378435 5:17259815-17259837 TAGACAGACCATGATGGGCTTGG - Intronic
988789311 5:34592639-34592661 TAGGTAGAATATGCGGGGGTAGG - Intergenic
990275560 5:54192298-54192320 TAGTTAGAACATGTTGTGGTGGG - Intronic
990738387 5:58888387-58888409 TAGGTTGAGCAAGAGGGGCTGGG - Intergenic
995131553 5:108636011-108636033 CAGGTAGACCAAGATGGGCTAGG + Intergenic
995481179 5:112594795-112594817 GAGGAAGAGCATGGTGGGTTTGG + Intergenic
997880757 5:137587474-137587496 GAGATAGTGCAGGATGGGGTAGG + Intronic
998944303 5:147321042-147321064 TGGGTCAAGCATGATGGAGTAGG + Intronic
999720591 5:154396467-154396489 GAGGAAGACCATGATAGGGTGGG + Intronic
1000020196 5:157311640-157311662 TGGGTAGAAAATTATGGGGTCGG - Intronic
1002310141 5:178309245-178309267 TAGGCAGAGGCTGATGGGGAGGG + Intronic
1003597726 6:7489055-7489077 AAGGTACAGCATGGTGGGTTTGG - Intergenic
1006197483 6:32254846-32254868 GAGGAAGAGGATGATGGGGTGGG + Intergenic
1007962124 6:45969450-45969472 TGGATAGAGCAGGAGGGGGTGGG - Intronic
1009481370 6:64162042-64162064 TAGGTAGAGCAAGAGGGTATAGG - Intronic
1011372202 6:86649132-86649154 CAGGTAGAGTAGGATGGGGTGGG + Intergenic
1016250994 6:142042814-142042836 TAGGCAGAGGAAGATGGGGTGGG + Intergenic
1017530860 6:155290956-155290978 TAGGTAGCTCAAGATGGGGCTGG + Intronic
1019104789 6:169659537-169659559 CAGGAAGAACATGATGGGGAGGG + Intronic
1019569552 7:1704553-1704575 TAGGTGGAGCCTCCTGGGGTGGG - Intronic
1019907219 7:4073947-4073969 TAGGCTGAGCACTATGGGGTGGG + Intronic
1020848577 7:13319715-13319737 TTGGTGGAGTATGATGGGGAGGG + Intergenic
1024822542 7:53350204-53350226 TAGACAGAGCCTGCTGGGGTGGG - Intergenic
1026787853 7:73313131-73313153 CAGGTAGAGCCCGATGCGGTGGG + Exonic
1034429981 7:151036395-151036417 TCGGAAGAGCAAGTTGGGGTGGG - Intronic
1038632411 8:29258540-29258562 TAGCTAGAGAATGATGGGACAGG - Intronic
1038637929 8:29302353-29302375 TAGGAAGAGTATGACAGGGTTGG + Intergenic
1039404661 8:37302203-37302225 GAGGCTGAGCAAGATGGGGTGGG + Intergenic
1045924784 8:107571334-107571356 TAGGAAGAACATCACGGGGTGGG - Intergenic
1051874513 9:21777251-21777273 TAGGGTGAACATGATGGGGTTGG + Intergenic
1052520741 9:29545912-29545934 TGGATGGAGCATGTTGGGGTTGG - Intergenic
1052960212 9:34289259-34289281 TAGGGAGACCATGATAGGGCAGG - Intronic
1055780504 9:79816088-79816110 GAGGAAGAGCATGGTGGGGTGGG - Intergenic
1058132489 9:101268500-101268522 AAGGTAGAGAGTGATGGGGGAGG - Intronic
1058720700 9:107760904-107760926 CAGGGAGAGGATGAAGGGGTAGG + Intergenic
1058877839 9:109259579-109259601 TAGATAGATTATGATAGGGTTGG - Intronic
1059451891 9:114376194-114376216 GGGGTAGAGCCTGGTGGGGTGGG - Intronic
1059603904 9:115812391-115812413 TAGGTACACCATAATGAGGTAGG + Intergenic
1061236090 9:129343440-129343462 GAGGGAGCGCAGGATGGGGTGGG + Intergenic
1185836924 X:3353235-3353257 TCCGTAGAGCAGGATGGGGGTGG + Intergenic
1191988475 X:67006885-67006907 TATGTAGAGCATGTTGGCTTTGG - Intergenic
1192496037 X:71617187-71617209 TAGGTGGAGCAGGAAGGTGTCGG + Exonic
1195432121 X:104800846-104800868 TAAGGAGAGCATGATGTGGAGGG + Intronic
1196380924 X:115088451-115088473 TGGCTGGAGCATGATGGGTTGGG + Intergenic
1197929252 X:131678367-131678389 AAAGGAGAGCATGATGGGCTGGG - Intergenic
1198324028 X:135549405-135549427 TAGGTTAAGAATGGTGGGGTGGG + Intronic