ID: 983649506

View in Genome Browser
Species Human (GRCh38)
Location 4:170024630-170024652
Sequence CCAGACTATTTGGCTAAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 122}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983649506 Original CRISPR CCAGACTATTTGGCTAAAAT GGG Intronic
904018810 1:27445597-27445619 CCTGAGCATCTGGCTAAAATTGG - Intronic
904134153 1:28298141-28298163 CAAGATTATTTGGTGAAAATGGG + Intergenic
905719860 1:40188427-40188449 CCAGTTTATTTGGTTACAATGGG - Intronic
906344831 1:45008603-45008625 CCAGACTAGTTGGCTGGAACAGG + Exonic
908792777 1:67799251-67799273 TCAGACTATTTGGTAAAAATGGG - Intronic
910541922 1:88369182-88369204 TTAGAATATTTGGCTAAAAATGG + Intergenic
911526167 1:98989169-98989191 ACAGCCTATTTGGTTAAAATGGG + Intronic
912248134 1:107982604-107982626 ACCAGCTATTTGGCTAAAATGGG - Intergenic
913703951 1:121399456-121399478 CCAAATTAATTGGCTAAATTGGG - Intergenic
913942598 1:125121953-125121975 CCAAATTAATTGGCTAAATTGGG - Intergenic
914977944 1:152383240-152383262 CAACACTATTTGGCAAAAAAAGG - Intergenic
915096591 1:153466855-153466877 TCTGACTAACTGGCTAAAATTGG - Intergenic
917237409 1:172909330-172909352 CCAGACTTTTTGGGCAGAATAGG + Intergenic
917799833 1:178560546-178560568 CCAGACGGTTTGGCTAAAGATGG - Intergenic
921771459 1:219045561-219045583 ACAGGCTGCTTGGCTAAAATGGG + Intergenic
922045531 1:221941716-221941738 ACAGGTTATTTGGTTAAAATGGG - Intergenic
922761761 1:228137239-228137261 ACAGGCTACTTGGTTAAAATGGG + Intergenic
1065532306 10:26684542-26684564 CTAGAATAGTTGGTTAAAATGGG - Intergenic
1068177479 10:53479689-53479711 CCAGACTTGTTGTCTAAATTAGG + Intergenic
1078315601 11:10290714-10290736 CTGGACTATTTGACTGAAATTGG + Intronic
1078343665 11:10523380-10523402 TCAGATTCTTTGGCTGAAATGGG + Intronic
1078678932 11:13456792-13456814 ACAGAGTATATGGCCAAAATTGG - Intronic
1079684000 11:23332818-23332840 CCAGATCATTTGGCCAGAATCGG - Intergenic
1080247221 11:30193248-30193270 GCAGACATTTTGGATAAAATAGG + Intergenic
1087581744 11:100064165-100064187 ACTGACTGTTTGGATAAAATGGG - Intronic
1087636301 11:100705156-100705178 TCAGATTATTTGGTTAAATTGGG - Intronic
1094225462 12:28040358-28040380 CAAGAATAATTAGCTAAAATAGG + Intergenic
1096451430 12:51745524-51745546 CCACAATATTTGGCTAGAATTGG - Intronic
1100735473 12:97524761-97524783 ACAGACTATTTGTTTCAAATAGG + Intergenic
1102936031 12:116897767-116897789 CCAGGCTCTTTTGCTACAATGGG + Intergenic
1105043525 12:132982163-132982185 CCAGACTTTTTGGTAAAAATTGG - Intergenic
1105709384 13:22991975-22991997 ACAGACTATGTGGCTCAAAGAGG - Intergenic
1107034655 13:35888123-35888145 CTAGACTTTTTGGCAAAAGTGGG - Intronic
1108948074 13:56047817-56047839 TCAGAATACTTGGCAAAAATAGG + Intergenic
1109066184 13:57695590-57695612 CCAGACTATATGTTAAAAATTGG - Intronic
1120225690 14:81788902-81788924 CCATACTATTTGGCTTCAATAGG - Intergenic
1120904838 14:89611386-89611408 CCAGTCTAACTGGCTATAATTGG - Intronic
1202939525 14_KI270725v1_random:134201-134223 CCAAATTAATTGGCTAAATTGGG + Intergenic
1123393614 15:19901700-19901722 CCAAATTAATTGGCTAAATTGGG - Intergenic
1136695942 16:32082118-32082140 CCAAATTAATTGGCTAAATTGGG + Intergenic
1136699618 16:32119068-32119090 CCAAATTAATTGGCTAAATTGGG - Intergenic
1136715914 16:32281245-32281267 CCAAATTAATTGGCTAAATTGGG - Intergenic
1136751998 16:32648520-32648542 CCAAATTAATTGGCTAAATTGGG + Intergenic
1136771294 16:32843832-32843854 CCAAATTAATTGGCTAAATTGGG + Intergenic
1136796437 16:33025371-33025393 CCAAATTAATTGGCTAAATTGGG + Intergenic
1136800111 16:33062244-33062266 CCAAATTAATTGGCTAAATTGGG - Intergenic
1136822590 16:33331946-33331968 CCAAATTAATTGGCTAAATTGGG - Intergenic
1136829153 16:33388485-33388507 CCAAATTAATTGGCTAAATTGGG - Intergenic
1136834219 16:33487267-33487289 CCAAATTAATTGGCTAAATTGGG - Intergenic
1136868263 16:33773392-33773414 CCAAATTAATTGGCTAAATTGGG - Intergenic
1136899285 16:34017621-34017643 CCAAATTAATTGGCTAAATTGGG - Intergenic
1136902514 16:34053508-34053530 CCTAATTATTTGGCTAAATTGGG - Intergenic
1136958009 16:34806254-34806276 CCAAATTAATTGGCTAAATTGGG - Intergenic
1137083895 16:36099001-36099023 CCAAATTAATTGGCTAAATTGGG + Intergenic
1138022640 16:53498357-53498379 ACAAACTATTTGGTTAAATTAGG - Intronic
1203010697 16_KI270728v1_random:237253-237275 CCAAATTAATTGGCTAAATTGGG + Intergenic
1203054140 16_KI270728v1_random:908506-908528 CCAAATTAATTGGCTAAATTGGG + Intergenic
1203073719 16_KI270728v1_random:1105942-1105964 CCAAATTAATTGGCTAAATTGGG + Intergenic
1203103911 16_KI270728v1_random:1342884-1342906 CCAAATTAATTGGCTAAATTGGG + Intergenic
1203129603 16_KI270728v1_random:1619484-1619506 CCAAATTAATTGGCTAAATTGGG - Intergenic
1143860408 17:9886441-9886463 ACAAACAAGTTGGCTAAAATAGG - Intronic
1145690535 17:26734101-26734123 CCAAATTAATTGGCTAAATTGGG - Intergenic
1150184513 17:63165993-63166015 GATGACTATTTGGCTTAAATGGG - Intronic
1151169683 17:72236353-72236375 CCACCCTATCTGGCCAAAATGGG - Intergenic
1153881612 18:9426112-9426134 CCATACTTTTTGGTTAAAGTTGG + Intergenic
1154517946 18:15195379-15195401 CCAAAGTAATTGGCTAAATTGGG + Intergenic
1155644306 18:28058943-28058965 ACAGGCTATTTGGTTAAAACAGG + Intronic
1156117670 18:33805779-33805801 CCAGACTGTTTGGCTCAAGTCGG - Intergenic
1158295405 18:55991464-55991486 CAAGAATATTTTGATAAAATGGG - Intergenic
1202670183 1_KI270709v1_random:42767-42789 CCAAATTAATTGGCTAAATTGGG - Intergenic
929803298 2:45122692-45122714 CCAGGCTATTTGGGTATTATTGG - Intergenic
932432015 2:71681783-71681805 CCAGCCTACTTGGCTCAAGTTGG + Intronic
937056716 2:118943760-118943782 CCATACTGTTTGGCCAAAATTGG + Intronic
938517865 2:132035616-132035638 CCAAATTAATTGGCTAAATTGGG + Intergenic
938601408 2:132845003-132845025 CCAGTCTATTTGGTGAAAAAAGG + Intronic
944831343 2:203535914-203535936 AGAGACTTTTTGGCCAAAATGGG - Intergenic
945414497 2:209554313-209554335 CCAGAGTAGTGGGCTAAATTTGG - Intronic
945720914 2:213417256-213417278 CCAGTTTATTTGCCTCAAATAGG - Intronic
948210892 2:236192387-236192409 CCAGATTGGTTGGCTAACATTGG + Intergenic
1168997700 20:2145276-2145298 CTATACTATTTGGCCATAATGGG - Exonic
1176583666 21:8552888-8552910 CCAAATTAATTGGCTAAATTGGG - Intergenic
1180266476 22:10529821-10529843 CCAAATTAATTGGCTAAATTGGG - Intergenic
1184237900 22:43195122-43195144 CAAGACTGTTTGGCTACTATGGG + Intergenic
1203324667 22_KI270738v1_random:2534-2556 CCAAATTAATTGGCTAAATTGGG + Intergenic
949185493 3:1187070-1187092 CCATTCTATGTGGATAAAATAGG - Intronic
951772785 3:26277410-26277432 CCAGACTAAGTGACTAAAACTGG - Intergenic
957146060 3:76425164-76425186 CCATTCAATTTGCCTAAAATAGG + Intronic
959184574 3:103030238-103030260 ATAGAATATTTGGCTAATATGGG - Intergenic
959570314 3:107875807-107875829 TCAGACTATTTGGGTAGAAAAGG + Intergenic
960462281 3:117951266-117951288 CCAGACAATTTTGCTAAATTAGG - Intergenic
961337331 3:126188917-126188939 ACAGGCTATTTGGTTAAAATGGG - Intronic
964606872 3:158569889-158569911 CCAGAGAACTTGGCTAAAAAAGG + Intergenic
967222622 3:187260449-187260471 CCAGACCAATTGCCTACAATAGG + Intronic
967378280 3:188829641-188829663 CAAGTATATGTGGCTAAAATTGG + Intronic
967768707 3:193310933-193310955 CCAGACTATTTTTCCAAGATGGG + Intronic
971641794 4:29143525-29143547 CCAGACTACTTAACAAAAATTGG - Intergenic
976381859 4:84408475-84408497 CCAGAATATGTGGATAACATAGG - Intergenic
978058380 4:104303428-104303450 TCAGACCATTTGCCCAAAATAGG + Intergenic
980791796 4:137630618-137630640 CCTGTGTACTTGGCTAAAATAGG + Intergenic
980801672 4:137759158-137759180 CCAGTCTATGTGGCTTACATGGG - Intergenic
983649506 4:170024630-170024652 CCAGACTATTTGGCTAAAATGGG + Intronic
984353804 4:178631857-178631879 AGAGACTATTTTGATAAAATTGG - Intergenic
989701503 5:44270982-44271004 CCAGAATAATAGGCTCAAATTGG - Intergenic
991146470 5:63311707-63311729 CTAGACTACTTGGTTTAAATAGG - Intergenic
992870130 5:80997522-80997544 CCAGGCAAGTTGGCTAAAATGGG + Intronic
993712236 5:91237046-91237068 TCAGCCTACTTGGTTAAAATGGG - Intergenic
993913664 5:93714356-93714378 CCAGTCCATTTGGCCAAACTTGG - Intronic
996525920 5:124479346-124479368 CCACAATGTTTGGCTAATATTGG - Intergenic
999581793 5:153047102-153047124 TCAGACTGTTCTGCTAAAATTGG - Intergenic
999854045 5:155574314-155574336 CAGCATTATTTGGCTAAAATCGG + Intergenic
1001540142 5:172532065-172532087 CCAGCCTCTTAGGCTAGAATGGG - Intergenic
1001585126 5:172828689-172828711 CCAGAGTATCTGCCTAAAAGAGG + Intergenic
1001938632 5:175725490-175725512 CCAAAGTATTTGTCTAAAAATGG - Intergenic
1002671025 5:180867445-180867467 CCACACAATGTGGCTTAAATAGG + Intergenic
1009993718 6:70876368-70876390 CCACACTATTTCATTAAAATAGG - Intronic
1011288185 6:85747140-85747162 ACAGGCTACTTGCCTAAAATAGG - Intergenic
1013425910 6:110012317-110012339 CCTGACCATTTGGTTCAAATTGG + Intergenic
1014189447 6:118475899-118475921 CCAGACTATATGGCAAAGTTAGG + Intronic
1024244494 7:47458952-47458974 CCATCCTATCTGGCTAAAGTTGG - Intronic
1025553041 7:62273292-62273314 CCAAATTAATTGGCTAAATTGGG + Intergenic
1025562349 7:62383148-62383170 CCAAATTAATTGGCTAAATTGGG - Intergenic
1025877968 7:65506599-65506621 CCAAATTAATTGGCTAAATTGGG + Intergenic
1025882304 7:65552393-65552415 CCAAATTAATTGGCTAAATTGGG + Intergenic
1025891138 7:65650209-65650231 CCAAATTAATTGGCTAAATTGGG - Intergenic
1032465991 7:132145393-132145415 CCACCCTACTTGGGTAAAATTGG + Intronic
1035014863 7:155756901-155756923 CCTGATTTTGTGGCTAAAATAGG + Intronic
1046002464 8:108437610-108437632 GCTGACTACTCGGCTAAAATTGG - Intergenic
1046033479 8:108811953-108811975 GCAGGCTACTTGGTTAAAATGGG + Intergenic
1049043212 8:140128510-140128532 CCAGACTTTTTTGGAAAAATTGG - Intronic
1057093968 9:92287852-92287874 CCAGAGGATGTGGCCAAAATGGG - Exonic
1203613621 Un_KI270749v1:30656-30678 CCAAATTAATTGGCTAAATTGGG - Intergenic
1199049318 X:143218330-143218352 CCACAATTTTTGGCCAAAATTGG + Intergenic
1199423156 X:147670037-147670059 CCAGAGTTTTTAGCTATAATCGG - Intergenic