ID: 983649791

View in Genome Browser
Species Human (GRCh38)
Location 4:170026504-170026526
Sequence TTCGCGGCAGCCGCGGGCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 137}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983649775_983649791 27 Left 983649775 4:170026454-170026476 CCAGTGCGGCTCGCCGGGCGGCG 0: 1
1: 0
2: 1
3: 22
4: 106
Right 983649791 4:170026504-170026526 TTCGCGGCAGCCGCGGGCGGGGG 0: 1
1: 0
2: 0
3: 15
4: 137
983649780_983649791 14 Left 983649780 4:170026467-170026489 CCGGGCGGCGCGGAGGCGCGGGT 0: 1
1: 0
2: 3
3: 28
4: 201
Right 983649791 4:170026504-170026526 TTCGCGGCAGCCGCGGGCGGGGG 0: 1
1: 0
2: 0
3: 15
4: 137
983649774_983649791 28 Left 983649774 4:170026453-170026475 CCCAGTGCGGCTCGCCGGGCGGC 0: 1
1: 0
2: 1
3: 5
4: 60
Right 983649791 4:170026504-170026526 TTCGCGGCAGCCGCGGGCGGGGG 0: 1
1: 0
2: 0
3: 15
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983649791 Original CRISPR TTCGCGGCAGCCGCGGGCGG GGG Intronic
900135417 1:1115413-1115435 TTCCCGGCAGCCGGGAGTGGGGG - Intronic
900189984 1:1349227-1349249 CGCGCGGGAGCCGGGGGCGGCGG - Intronic
904782992 1:32964542-32964564 GGCGCGGCGGCCGCGGGCCGAGG + Exonic
905553143 1:38859745-38859767 GTGGCGGCTGCCGGGGGCGGTGG - Exonic
905710334 1:40096993-40097015 GTCGAGGCAGCCGCGTGCTGTGG + Intronic
906640847 1:47439450-47439472 TTCGCGGCAGCCGCGGGTCCTGG + Exonic
915302880 1:154961594-154961616 TTAGCGGCAGCGGCGGGGGATGG + Exonic
915616898 1:157045945-157045967 GCCGCGGCGGCCGGGGGCGGGGG + Intergenic
915740194 1:158113437-158113459 GGCTCGGCAGGCGCGGGCGGCGG + Intergenic
1065140169 10:22713355-22713377 GTCCCGGCGGGCGCGGGCGGAGG - Intronic
1071086891 10:81875428-81875450 GCGGCGGCAGCGGCGGGCGGGGG + Exonic
1073513578 10:104057891-104057913 TTAGGGGCAGCTGGGGGCGGGGG + Intronic
1076650240 10:131982235-131982257 GTCGCCGCCGCGGCGGGCGGTGG + Intergenic
1076811939 10:132891146-132891168 TTCGCGGCAGCCACGACCAGGGG + Intronic
1077476207 11:2791683-2791705 TTGGCGGCAGCTGCGGGTGGGGG + Intronic
1078382614 11:10858028-10858050 TTCGCGGCTGGCGCGGTCGCCGG + Exonic
1080457737 11:32431111-32431133 TTCTCTGCAGCCGCCGGCGGGGG - Intronic
1081831985 11:46121720-46121742 GTCCCGGGAGCCGCGGGCCGAGG - Intergenic
1084146139 11:67266392-67266414 TGCGCGGCAGGCGGGGCCGGAGG + Exonic
1094041078 12:26122481-26122503 GCCGCGGCGGCCGCGGGCTGCGG + Exonic
1096648168 12:53049262-53049284 TTCGGGGTTGCCGCGGGGGGAGG + Intronic
1097281110 12:57846001-57846023 CCCGGGGCAGCCGCGCGCGGCGG + Intronic
1100679850 12:96907332-96907354 TGCGCGGACGCGGCGGGCGGGGG - Intronic
1101990091 12:109477323-109477345 CTCACGCCAGCCGGGGGCGGAGG + Exonic
1103479270 12:121240744-121240766 TGCGGGGGAGCCGGGGGCGGGGG + Exonic
1104692745 12:130839046-130839068 TGAGCGGCAGCCGCGGGTAGCGG - Intronic
1105059018 12:133130527-133130549 TTCGCAGCAGGGGCGGGCGTAGG + Intergenic
1109262757 13:60163671-60163693 TTCCCGGCAGCCGCGGAGAGAGG + Exonic
1110443406 13:75549873-75549895 TTCGGGGCAGCCCTGGGCCGTGG + Intronic
1113803699 13:113100963-113100985 TTTGCTGCAGCCGGGCGCGGTGG - Intergenic
1114736724 14:25050013-25050035 GGCGCGGGAGCCGCGAGCGGCGG - Exonic
1115502228 14:34060199-34060221 TTCGGGGCGGCCGCGGGCGCAGG - Intronic
1118324967 14:64774470-64774492 TTTGCGGCAGCAGCGTGCGGTGG - Exonic
1118809043 14:69260527-69260549 TGCGCGGCGGCCGAGGGCGCGGG + Intronic
1118930303 14:70234627-70234649 TACGAGGCAGCCTCGGGCAGGGG + Intergenic
1122418305 14:101560738-101560760 CGCGCGGCAGCCTCGGGCAGCGG + Intergenic
1122624162 14:103075669-103075691 CCCTCGGCGGCCGCGGGCGGAGG - Intergenic
1122631877 14:103111036-103111058 TTGGCGGCAGCTGCGGGCTGGGG + Intergenic
1131054135 15:89365668-89365690 CTCGCGGTAACCGCGCGCGGAGG - Intergenic
1131076211 15:89496505-89496527 TGAGCGGCAGCCGCCAGCGGAGG + Exonic
1132854364 16:2038272-2038294 CGCGCGGCAGCCGCGGGGCGAGG + Exonic
1133867515 16:9658059-9658081 CTCTCAGCAGCCGGGGGCGGGGG + Intergenic
1134696983 16:16232527-16232549 TGCGCGGCGGCGGCTGGCGGCGG + Exonic
1135250884 16:20900364-20900386 TTCGGGGCGGCCGCCGCCGGTGG - Exonic
1139530104 16:67538523-67538545 TCCTCGGCAGCCACGAGCGGGGG + Exonic
1141989660 16:87602705-87602727 AGCGCGGCAGCCGCAGGTGGGGG + Intronic
1142005984 16:87689822-87689844 CTGGCGGCGGGCGCGGGCGGCGG - Exonic
1142752769 17:1998428-1998450 CTCGCGGGAGCCGCCGGCCGGGG + Intronic
1142764361 17:2057216-2057238 TCCGCGGCAGGCGGCGGCGGAGG - Exonic
1145110182 17:20155780-20155802 TTCTCAGCATCCGCGGGCGGAGG + Intronic
1145815783 17:27793898-27793920 TCCGCGGCAGACGCCGGCTGCGG - Intronic
1145839747 17:27984635-27984657 TTGCCGGCAGCCGGGGGGGGGGG - Intergenic
1146095828 17:29929807-29929829 TTCGCGGCAGCCGAGTGCCAAGG + Intronic
1146403685 17:32519536-32519558 TTCGTTTCAGCCGCGGGCGCTGG - Intronic
1148336038 17:46841950-46841972 CTCGCGGCGGCCGCGGACGCTGG - Intronic
1148555514 17:48576697-48576719 TTCGTGGCTCCCGCGTGCGGGGG + Exonic
1148818202 17:50345911-50345933 GTCCCGGCAGTCGCGGGCGTGGG - Intergenic
1151218254 17:72592392-72592414 CTCGCGGAGGTCGCGGGCGGGGG + Intergenic
1152245555 17:79183074-79183096 TGCGCGGCGGCCGAGCGCGGGGG - Intronic
1152635140 17:81427729-81427751 TGCGTGCCAGCCGCGGGGGGCGG - Intronic
1153226935 18:2906797-2906819 TTCGGGGCCTCTGCGGGCGGCGG - Exonic
1154070808 18:11149705-11149727 GGCGCGGGAGCCGCGGGTGGGGG - Intergenic
1154199240 18:12287844-12287866 TCCGCTGCAGCTGCAGGCGGGGG + Intergenic
1155152792 18:23135871-23135893 GGCGCGGCGGCCGCGGGCTGAGG - Exonic
1161820927 19:6531092-6531114 TACGCGGCAGGCGCGAGCGCGGG - Exonic
1162118234 19:8445153-8445175 TCCGCGGCCGACGCGGGCGGCGG + Intronic
1163427095 19:17245743-17245765 GGAGCGGCAGCCGCGGGCGCCGG - Exonic
1163700008 19:18782194-18782216 TGGGCGGCCGCAGCGGGCGGGGG + Exonic
1165420040 19:35718019-35718041 ATGGCGGCGGCGGCGGGCGGCGG + Exonic
1165533239 19:36421562-36421584 GTCTCGGCAGCCGCGGCCCGCGG - Intergenic
1165852702 19:38859445-38859467 TTGGCGGCTGCCGGGGGCTGAGG - Intergenic
1167145733 19:47680130-47680152 CTCGGGACAGCCGCTGGCGGTGG + Exonic
925093031 2:1170394-1170416 TTCCCGGCTGCCGAGGGCTGGGG - Intronic
927721946 2:25388761-25388783 TTGCCGGCAGCAGCGGGGGGAGG - Intronic
927809222 2:26172782-26172804 TTGGCGGCAGCGGCGGGTGGGGG + Intergenic
927887599 2:26728242-26728264 TCCACGGCGGCAGCGGGCGGCGG + Exonic
928186655 2:29115989-29116011 CTCGGGGCAGCCGCGGCTGGCGG - Intronic
929461089 2:42102423-42102445 TTTGCGGCCGCCGTGGGCGTGGG - Intergenic
932567358 2:72918153-72918175 GCCGCGGCCGCCGCGGGCGCGGG + Exonic
939613006 2:144332515-144332537 TCCGCGGCGGCCGCGGGGGAGGG - Intronic
942241126 2:173964730-173964752 TTACAGGCAGCGGCGGGCGGGGG - Intronic
942278600 2:174340557-174340579 CTCCCGGGAGCGGCGGGCGGCGG + Intergenic
944585163 2:201166402-201166424 GACGGGGCAGCTGCGGGCGGAGG + Exonic
1168883400 20:1226019-1226041 TGCGCGGCAGGCGCGGGGCGGGG - Intergenic
1171346430 20:24469550-24469572 CTCGGGGCAGCCGGGGGCGCAGG + Exonic
1172116124 20:32574632-32574654 TTCTCGGCATCCCCGGGCTGAGG - Intronic
1176234614 20:64048605-64048627 TCCTCGGGCGCCGCGGGCGGTGG + Exonic
1179290364 21:40013168-40013190 GTCGTGGCAGCCGGGGGCCGTGG - Exonic
1181299145 22:21867266-21867288 TCCGCTGCGGCCCCGGGCGGTGG + Intronic
1182222978 22:28773096-28773118 CTCGCGGCGGGCGCGGGCAGGGG + Intronic
1183395465 22:37568649-37568671 TGCGCGGCAGGAGCGGGTGGAGG + Exonic
1183504487 22:38201838-38201860 ATCGCGGCAGCCCCGGGGGCGGG + Intronic
1185398544 22:50604551-50604573 GGCGCGGCGGGCGCGGGCGGCGG - Exonic
950618081 3:14178421-14178443 TTCGCGGGAGACGCCGCCGGTGG - Exonic
954025727 3:47781775-47781797 ATGGCCGCAGCGGCGGGCGGCGG - Exonic
956658948 3:71581522-71581544 GTCGAGGCGGCCGCGGGCGCGGG - Intronic
961012937 3:123448189-123448211 GTCGCGGCAGCCGCCGGCAGCGG - Exonic
968701057 4:2058648-2058670 TGCGCGGCCGCGGGGGGCGGGGG + Intergenic
968775399 4:2536866-2536888 GGCGCGGGGGCCGCGGGCGGCGG - Intronic
972290674 4:37686892-37686914 TACGCGGGAGCCCGGGGCGGGGG + Intergenic
972621203 4:40749916-40749938 TTCATGGCAACCGCGAGCGGAGG - Exonic
978503502 4:109433676-109433698 TCGGCGGCCGCCGCGGGCGCGGG - Intergenic
979565727 4:122152415-122152437 TGGGCGGCGGCCCCGGGCGGCGG + Exonic
980053795 4:128061534-128061556 TGCGCGGCCTCGGCGGGCGGCGG + Intronic
983649791 4:170026504-170026526 TTCGCGGCAGCCGCGGGCGGGGG + Intronic
990581827 5:57173576-57173598 TCCGAGGCAGCCCCGGACGGGGG + Intergenic
992487589 5:77210875-77210897 GTCCCGGCGGCCGCGGGCGCGGG + Exonic
992950368 5:81852014-81852036 AGCGCGGCAGCCGCGGCGGGAGG - Intergenic
997870200 5:137499349-137499371 GGCGCGGCGTCCGCGGGCGGAGG + Intronic
998366653 5:141636826-141636848 CTGGCGGCGGCCGCGGGCGGCGG - Exonic
998797539 5:145835558-145835580 TTCTCGGCAGGCGCGGCCGCGGG - Intergenic
1003395607 6:5749869-5749891 TTCGTGGCAGCCGTGAGTGGAGG - Intronic
1004615060 6:17281466-17281488 TTCGCGGCCGCCGGGGGCCAAGG - Exonic
1004720586 6:18264675-18264697 GTCGCCTCGGCCGCGGGCGGAGG + Exonic
1006396229 6:33789131-33789153 TGCGCGCCAGGGGCGGGCGGGGG - Exonic
1006834143 6:36986408-36986430 GTGGCGGCAGCCGCAGGCCGGGG + Intergenic
1008554829 6:52664530-52664552 TACGAGGCAGCCGCCGACGGCGG + Intergenic
1014098240 6:117482789-117482811 TGCGCCGCCGCCGCGGGCGCCGG - Exonic
1018078097 6:160234124-160234146 TTCTCGGCAGGCAGGGGCGGGGG - Intronic
1018942605 6:168319461-168319483 GGCGCGGCGGGCGCGGGCGGGGG + Exonic
1019434939 7:1017733-1017755 TAAGGGGCAGCCGCGGACGGCGG + Intronic
1019456499 7:1130438-1130460 TTCGCTGCAGCAGCAGGCGTGGG - Intronic
1021845269 7:24757368-24757390 TGCGCGGCGGGCGCGGGCTGCGG - Intronic
1029154280 7:98503951-98503973 TTGCCGGCAGCCGCAGGCAGAGG + Intergenic
1029414834 7:100436186-100436208 GGCACGGCAGCCCCGGGCGGCGG - Exonic
1032344453 7:131106220-131106242 CACGCAGCAGCCGGGGGCGGCGG - Intergenic
1033115622 7:138622476-138622498 GTGGAGGCAGCGGCGGGCGGGGG + Intronic
1034455499 7:151167812-151167834 GGCGCGGCGGCGGCGGGCGGAGG - Intronic
1038540384 8:28385959-28385981 GGCGCGGCAGCCGGGGACGGGGG - Intronic
1039884768 8:41648625-41648647 TTGGCGGAAGCCGGGGGTGGAGG - Intronic
1040065311 8:43140339-43140361 CGCCCGGGAGCCGCGGGCGGGGG - Intergenic
1043428453 8:80171539-80171561 TTCGCGGGAGTCGCCGGCGGAGG - Intronic
1043502948 8:80874269-80874291 GGCGCGGCGGCCGCGGGCGGGGG + Intronic
1043847161 8:85177085-85177107 TTCTAGGCAACGGCGGGCGGCGG + Intergenic
1049230790 8:141480172-141480194 CTCGCTGCAGCCGCAGGCAGAGG - Intergenic
1049755592 8:144310048-144310070 GTTGCAGCAGCCACGGGCGGCGG - Intronic
1049828311 8:144684807-144684829 TCTGCGGCAGGCGCGGGCTGGGG - Intergenic
1053763024 9:41358717-41358739 TGCGGCGCAGCCCCGGGCGGCGG - Intergenic
1054541630 9:66269831-66269853 TGCGGCGCAGCCCCGGGCGGCGG - Intergenic
1054820458 9:69516232-69516254 GGCGGGGCAGCAGCGGGCGGTGG - Exonic
1056135122 9:83623354-83623376 GGCGCGGCAGCCGCGGGCCTCGG - Intronic
1057436862 9:95048557-95048579 GTCCCGGCCGCCGCGGCCGGAGG - Intronic
1060825100 9:126683278-126683300 GCGGCGGGAGCCGCGGGCGGGGG - Intronic
1061991792 9:134163353-134163375 TTCGCGGCTGCGGCGGGGCGAGG - Intergenic
1062363725 9:136199187-136199209 TTCTCGGAAGGCGCGGGCGCTGG + Intronic
1062587267 9:137255012-137255034 CTCGCGGCAGCCACGCGCAGCGG - Intergenic
1187181447 X:16946898-16946920 GCAGCGGCAGCGGCGGGCGGGGG + Exonic
1189002875 X:36963969-36963991 GCCGCGGGAGCCGCGGGCGGGGG - Intergenic
1189310021 X:40012423-40012445 TCCGCGGCAGCTGCGGGCAGAGG - Intergenic
1196684070 X:118495887-118495909 GCCGCGGCCGCCGCGGGCCGGGG + Exonic
1198750464 X:139932680-139932702 GGCGCGGCAGCCGCGGACCGAGG - Intronic
1198800565 X:140443991-140444013 TTCATGGCGGCCGGGGGCGGTGG + Intergenic
1199772740 X:150984405-150984427 CGCGCGGCCGGCGCGGGCGGCGG - Intronic