ID: 983650079

View in Genome Browser
Species Human (GRCh38)
Location 4:170028348-170028370
Sequence CTGTCTAAGGAGGAGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 676
Summary {0: 1, 1: 0, 2: 5, 3: 58, 4: 612}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983650073_983650079 19 Left 983650073 4:170028306-170028328 CCTTTCATTGAGAGCAGAAAGGC 0: 1
1: 0
2: 0
3: 16
4: 167
Right 983650079 4:170028348-170028370 CTGTCTAAGGAGGAGGAGGATGG 0: 1
1: 0
2: 5
3: 58
4: 612
983650070_983650079 30 Left 983650070 4:170028295-170028317 CCCAAAGAGAGCCTTTCATTGAG 0: 1
1: 0
2: 0
3: 8
4: 181
Right 983650079 4:170028348-170028370 CTGTCTAAGGAGGAGGAGGATGG 0: 1
1: 0
2: 5
3: 58
4: 612
983650071_983650079 29 Left 983650071 4:170028296-170028318 CCAAAGAGAGCCTTTCATTGAGA 0: 1
1: 0
2: 0
3: 18
4: 152
Right 983650079 4:170028348-170028370 CTGTCTAAGGAGGAGGAGGATGG 0: 1
1: 0
2: 5
3: 58
4: 612

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983650079 Original CRISPR CTGTCTAAGGAGGAGGAGGA TGG Intronic
900768411 1:4520789-4520811 CTGTCTGTGGTGGAGGTGGAGGG - Intergenic
900768442 1:4520933-4520955 CTGTCTGTGGTGGAGGTGGAGGG - Intergenic
901421546 1:9154538-9154560 CTGACTCAGGAGGAAGAGGAAGG - Intergenic
901689285 1:10962060-10962082 GTCTGTGAGGAGGAGGAGGAAGG - Intronic
901876509 1:12169825-12169847 CTGTCTGGGGAGGAGGATGAGGG + Intronic
902370244 1:16002140-16002162 CTGGCTTTGGAGGCGGAGGACGG - Intergenic
902987022 1:20161092-20161114 CTGTGTGAGGAGGAGATGGAGGG + Intergenic
903491079 1:23729081-23729103 ATCTTGAAGGAGGAGGAGGAAGG - Intergenic
903548632 1:24142625-24142647 CTGACAGGGGAGGAGGAGGAAGG - Intronic
904021719 1:27471711-27471733 CTGACAAAGGAGGATCAGGAAGG + Intronic
905257128 1:36692078-36692100 CAGTCTGAGGAGGATGAGCATGG - Intergenic
905310180 1:37043574-37043596 CTGTCACAGGGGGAGTAGGAGGG + Intergenic
905371719 1:37486031-37486053 CTGTGAAAGGAGGAGAGGGAGGG + Intergenic
905460283 1:38118374-38118396 CTGTCTCAGGGTGAGCAGGATGG + Intergenic
905791009 1:40789533-40789555 GAGTGCAAGGAGGAGGAGGAAGG - Intronic
906288338 1:44602978-44603000 CGGCCCGAGGAGGAGGAGGAGGG - Intronic
907330069 1:53664939-53664961 CTGTGGCAGGAGGAGGGGGAGGG + Intronic
907429560 1:54404404-54404426 CTGGCCAAGGAGGAGAAGGGCGG - Intronic
907804118 1:57801612-57801634 CATGCTAAGGAGGAAGAGGAAGG - Intronic
908323502 1:63000942-63000964 CTTTTTAAGGCAGAGGAGGATGG + Intergenic
908512771 1:64862518-64862540 CTGTGGAGGGAGCAGGAGGAGGG - Intronic
908534646 1:65066744-65066766 GTGCCGGAGGAGGAGGAGGAGGG - Intergenic
908850527 1:68371451-68371473 CTGTCTATCGACCAGGAGGAGGG - Intergenic
909142555 1:71887229-71887251 TAGGCTGAGGAGGAGGAGGAAGG + Intronic
909305504 1:74070749-74070771 CTGTTGAAGGGGCAGGAGGAAGG + Intronic
909976416 1:82050822-82050844 GCTTCTAAGGATGAGGAGGAAGG + Intergenic
910094468 1:83505247-83505269 CTCTGGAAGGAGGAGGAGGCAGG - Intergenic
911035031 1:93533459-93533481 ATGACCAATGAGGAGGAGGAAGG + Intronic
911344623 1:96681530-96681552 CTCTGTGAGGAAGAGGAGGAAGG - Intergenic
912702023 1:111885162-111885184 GTGACTAAGGAGGAGGAAGGTGG + Intronic
913175369 1:116268217-116268239 CTGGCCAAGGCTGAGGAGGAGGG - Intergenic
914265122 1:146031962-146031984 ATGTCCAGGGAGGAGGACGAGGG + Intergenic
916508027 1:165445500-165445522 CTGTGAAAGGAGGAGGGGGTGGG + Intergenic
916787262 1:168095684-168095706 ATCTGTGAGGAGGAGGAGGATGG + Intronic
917943410 1:179945956-179945978 CTATCGAAGGTGGAGGTGGAAGG + Intergenic
918092301 1:181308114-181308136 CAGTCCCAGGAGGAGCAGGAGGG - Intergenic
918098192 1:181351378-181351400 CTCTCTGAGGTGGAGGAAGATGG + Intergenic
919663810 1:200273224-200273246 CTATCTATGGAGGAGGTGAATGG - Intergenic
919746935 1:201014552-201014574 CGGGCTTAGGAGGGGGAGGATGG + Intronic
920034663 1:203058195-203058217 CTGGCTGAGGAGGAGGAGGAGGG + Intronic
920054284 1:203181282-203181304 GTGTCTGAGGAGGAAGGGGATGG + Exonic
920210822 1:204327058-204327080 CTATCCCAGGAGGAGGAGGAGGG - Intronic
922217493 1:223532267-223532289 CTGTCTCAGGAGGCTGAGGCAGG - Intergenic
922368298 1:224886350-224886372 CAGGCTAAGGAGGAAGAGGGAGG - Intergenic
922551750 1:226499087-226499109 CTGTCCAGGGAAGAGGAGCAGGG + Intergenic
922879022 1:228965243-228965265 CAGGCTGAGGAGGAGGAGGATGG - Intergenic
923536736 1:234858251-234858273 GGGTCCAGGGAGGAGGAGGATGG - Intergenic
923746820 1:236708878-236708900 CTGACTAAAGTGGAAGAGGAAGG - Intronic
1063173371 10:3529760-3529782 CAGTCAGAGGAAGAGGAGGAGGG - Intergenic
1063286771 10:4697131-4697153 CTGTCTGAGGAGGATGGGCAAGG + Intergenic
1063447697 10:6130027-6130049 CTGTGTGCAGAGGAGGAGGAGGG - Intergenic
1063755126 10:8998654-8998676 GTTTTTAAGTAGGAGGAGGATGG + Intergenic
1063856234 10:10257324-10257346 CTGTCTGTGCAGCAGGAGGAGGG - Intergenic
1065478833 10:26171713-26171735 CTGCCTCAGGAGCAGGAGGCTGG + Intronic
1066156930 10:32688089-32688111 GTGTCCAAGGAAGATGAGGAAGG - Intronic
1066587538 10:36952905-36952927 CTGTATATGGAGAAGGAGGTGGG + Intergenic
1067013120 10:42732913-42732935 TGGGCTAAGGAGGAAGAGGAGGG + Intergenic
1067487816 10:46668491-46668513 CTGGCTGGGGAGGAGGAGCAGGG - Intergenic
1067606991 10:47673518-47673540 CTGGCTGGGGAGGAGGAGCAGGG + Intergenic
1067748243 10:48952664-48952686 CTGCATTAGGAGGAGGAGGGTGG - Intronic
1068505174 10:57891273-57891295 TTGTCTGGGGAGGAAGAGGAGGG + Intergenic
1069303526 10:66938928-66938950 CTTTCTCAGGAGGATGTGGACGG - Intronic
1069617322 10:69814314-69814336 GTTTCCCAGGAGGAGGAGGAGGG + Intronic
1069892329 10:71659808-71659830 CCATCTGATGAGGAGGAGGAAGG + Intronic
1070925818 10:80220856-80220878 GTGTCTATGGTGGGGGAGGAAGG - Intergenic
1070976409 10:80609304-80609326 AGGTAAAAGGAGGAGGAGGAAGG - Intronic
1071399658 10:85256891-85256913 CTGGCAAAGGAGGAGATGGAAGG - Intergenic
1071712383 10:88062337-88062359 CTGTGTGAGGAGGTGGGGGATGG - Intergenic
1071827790 10:89342429-89342451 TTGTTTAAGGAGCAGGAGGATGG - Intronic
1071835927 10:89416647-89416669 CAGCCCAAGGAGGATGAGGAGGG - Intronic
1072251777 10:93587371-93587393 CTGGATCAGGATGAGGAGGATGG - Exonic
1072619040 10:97067809-97067831 CTGGCCCAGGAGGAGGAGGTGGG - Intronic
1072620376 10:97075402-97075424 CTCTGTAGGGAGGAGGAGGGAGG + Intronic
1072635732 10:97176650-97176672 CTGTCTGAGGAGGAGGTCCAAGG - Intronic
1072946434 10:99813970-99813992 CTCTCAAAGGAGGAAGAGAAAGG - Intronic
1072982936 10:100114962-100114984 CTCTTTAAGGAGGAGTTGGACGG - Intergenic
1073420686 10:103421499-103421521 CTGATTCAGGAGGAGGAGGCTGG - Exonic
1074007496 10:109442806-109442828 ATGTCTTAGGAGGCTGAGGAGGG - Intergenic
1074082945 10:110182231-110182253 CTGTCTGGGCAGGAGGAAGAAGG - Intergenic
1074202938 10:111256058-111256080 CTCTAGAAGGAGGAGGAAGAGGG + Intergenic
1074204907 10:111274698-111274720 TTGTCTAAGGGGGAGCAGCAGGG + Intergenic
1074331230 10:112511706-112511728 TTGAATTAGGAGGAGGAGGAGGG - Intronic
1074388087 10:113033201-113033223 CAGCAGAAGGAGGAGGAGGAAGG - Intronic
1074533924 10:114315273-114315295 CTGTCTCACAAAGAGGAGGATGG + Intronic
1074829010 10:117235670-117235692 GGGTCTTGGGAGGAGGAGGAGGG - Intergenic
1075001991 10:118805434-118805456 CTGTCACAGGAGGACCAGGATGG - Intergenic
1075226426 10:120633685-120633707 CTGCCTGAGGGTGAGGAGGAAGG + Intergenic
1075542759 10:123329310-123329332 CTTTCCAATGAGGAGAAGGAAGG - Intergenic
1075866451 10:125725108-125725130 CTGGCTTAGGAGGAGGAAGACGG + Intronic
1076343023 10:129762612-129762634 CTGTCTGAGGATGAAGAGGAAGG - Intronic
1076691304 10:132225048-132225070 ATGCCTGAGCAGGAGGAGGAAGG - Intronic
1076733215 10:132448433-132448455 CCGCCTAAGAAGGAGAAGGAGGG + Exonic
1076762097 10:132611035-132611057 CTGTCAGAGGAGGATGAGGGAGG + Intronic
1076762148 10:132611219-132611241 CTGTCAGAGGAGGATGAGGGAGG + Intronic
1076762162 10:132611264-132611286 CTGTCAGAGGAGGATGAGGGAGG + Intronic
1077121435 11:910731-910753 CCGTGCAAGGAGGAGGAGCAGGG + Intronic
1077398677 11:2341181-2341203 CAGTCGTAGGAGGTGGAGGAGGG - Intergenic
1077439543 11:2561660-2561682 ATCGCTAAGCAGGAGGAGGATGG - Intronic
1078490177 11:11761016-11761038 CTGTCTTGGAAGAAGGAGGAAGG - Intergenic
1078836140 11:15031877-15031899 TAGGCTGAGGAGGAGGAGGAAGG - Intronic
1079986974 11:27209885-27209907 GTGTGTAAAGAGGAGGAAGATGG + Intergenic
1080727014 11:34908532-34908554 TTGACTGATGAGGAGGAGGAGGG - Intronic
1081156089 11:39692888-39692910 CTGTCTCAGGAGTAGCAGAAGGG - Intergenic
1081864613 11:46352651-46352673 CTGTTCAAGGAGGAGGCAGAGGG - Intronic
1081975990 11:47235160-47235182 CTGTCTAGAGAGGAGTGGGAGGG + Intronic
1081982205 11:47274813-47274835 ATCTCTAAGGAGAAGGGGGAAGG + Exonic
1083229902 11:61310176-61310198 CTGTCCTAGGAGGAGCAGAAAGG - Intronic
1083887741 11:65581081-65581103 CTTTGTGAGGAGGAGGAGGAAGG + Exonic
1083901131 11:65644104-65644126 TGGTTTAAGGAGGAGGAGCAGGG + Intronic
1083937618 11:65878401-65878423 CGGTCTAGGGATGAGGATGAGGG - Intergenic
1084129409 11:67121246-67121268 GTTCCTAAGGAGGAAGAGGAAGG + Exonic
1084576686 11:69993136-69993158 CTGTCTCAGGAGGGGGTGGCTGG - Intergenic
1084603136 11:70158459-70158481 CTGTATCAGCAGGAGGGGGATGG - Intronic
1084792598 11:71484059-71484081 CTGTCAGAGCTGGAGGAGGAGGG + Intronic
1084953584 11:72679773-72679795 CTGTCTCAGTTGGAGGAGGAAGG - Intergenic
1085024046 11:73226313-73226335 TTTTCTAAGGAGGAGGAGACAGG + Intronic
1085300161 11:75453170-75453192 CAGACTGGGGAGGAGGAGGAAGG + Intronic
1085431543 11:76454918-76454940 CAGTATTAGGAGGGGGAGGAGGG - Intronic
1085836829 11:79965986-79966008 GTGGCTAAAGAAGAGGAGGAGGG - Intergenic
1085885501 11:80517329-80517351 TTGTCTGAGCAGGAGGAAGAGGG - Intergenic
1086306289 11:85484245-85484267 ATGCCTAGGGAGGAGGAGGAGGG - Intronic
1086998927 11:93393024-93393046 AAGTAGAAGGAGGAGGAGGAGGG - Intronic
1087904796 11:103683135-103683157 CTCTCAGAGGAGTAGGAGGAGGG - Intergenic
1089299868 11:117492176-117492198 CTGTCATAGGAGGTAGAGGAGGG - Intronic
1089312690 11:117570336-117570358 CTGTCTAAGGAGAAGCAGAACGG - Intronic
1089749996 11:120644607-120644629 ATGTCTCAGGAGGAGGAGGAAGG + Intronic
1090391774 11:126393460-126393482 ATGGCTCAGGAGGAGGGGGATGG + Intronic
1090805370 11:130198924-130198946 CTGTTCAAGGAGGAGGACAAGGG - Intronic
1090952330 11:131484624-131484646 GTGTCTACGCAGGAGGAAGAGGG - Intronic
1091309189 11:134560841-134560863 TTTTTTAAGCAGGAGGAGGAGGG - Intergenic
1091670316 12:2447721-2447743 CTGGCTAGGCAGGAGGAGGTGGG + Intronic
1091777304 12:3192789-3192811 CTCCCTGAGGAGGAGGAGGAGGG + Intronic
1093286258 12:17267927-17267949 CTGTCAGAGGACCAGGAGGATGG + Intergenic
1095244935 12:39908592-39908614 GTGGCTGAGGAGGATGAGGAGGG + Intronic
1095459220 12:42424588-42424610 CTATCTTAGGAGGTTGAGGAGGG + Intronic
1095728372 12:45476809-45476831 CAGTCAAAGGAGGAAGAAGAGGG - Intergenic
1096858022 12:54499303-54499325 GTTTCTGAGGAGGAGGAGAAAGG + Intronic
1097008598 12:55936618-55936640 GGGTGTAATGAGGAGGAGGAGGG - Intronic
1098568227 12:71959078-71959100 CAGTATAAGCAGGAAGAGGAGGG - Intronic
1101122496 12:101597545-101597567 TCTTCTAAGGAGAAGGAGGAAGG + Intronic
1102418640 12:112786531-112786553 CTCTTAAAGGAGAAGGAGGAGGG + Intronic
1102485664 12:113253952-113253974 CTCTCTAAGGAAGAGGAGTCGGG - Intronic
1102893913 12:116583057-116583079 GGGTCAAAGAAGGAGGAGGAGGG + Intergenic
1103413720 12:120730458-120730480 CTGTGTAGGGAGGAGGAGGCTGG + Intronic
1104088101 12:125493907-125493929 ATTTCCAGGGAGGAGGAGGAGGG - Intronic
1104182899 12:126399502-126399524 GTGTTTAAGGAAGAGGAGAAAGG - Intergenic
1104372065 12:128232239-128232261 CTGGCTAAAGAGGAGAAGAAAGG + Intergenic
1105524174 13:21160290-21160312 CTGACAAAGGAGGAGGAAGACGG + Intronic
1105698515 13:22915469-22915491 CTGCCAAGGGAGGAGGAAGATGG + Intergenic
1105717527 13:23082093-23082115 TTGCCTGAGGAGGAGGAAGAAGG - Intergenic
1105722873 13:23134511-23134533 CTGGAAAAGGAGGAAGAGGAGGG + Intergenic
1105818114 13:24055415-24055437 CTGCCTAGGGAGATGGAGGATGG + Intronic
1105850184 13:24327716-24327738 CTGCCAAGGGAGGAGGAAGATGG + Intergenic
1105933626 13:25076749-25076771 TAGTCTGAGGAGGAGAAGGAGGG + Intergenic
1106570039 13:30918583-30918605 CATTCTGAGCAGGAGGAGGAAGG - Intronic
1106582027 13:31027088-31027110 CTGGAGAAGAAGGAGGAGGAGGG - Intergenic
1106784897 13:33096901-33096923 TAGACTGAGGAGGAGGAGGAGGG + Intergenic
1107733909 13:43375878-43375900 CTGTGTTAGGAAGAGGAGAAAGG - Intronic
1107826327 13:44332010-44332032 CTGACAAAGGAGGTGGTGGAGGG - Intergenic
1107871414 13:44749697-44749719 CTGTCAAGGGTGGAGGAGGATGG + Intergenic
1108293501 13:48987517-48987539 CTGACTAAGAAGGGTGAGGATGG + Intronic
1110760485 13:79225259-79225281 CTTCCTAGGGAGGGGGAGGAGGG + Intergenic
1111308469 13:86448243-86448265 CTGTCTGAGGAGGAGATAGAGGG - Intergenic
1111598521 13:90441991-90442013 GTGTGAAAGGAGAAGGAGGAGGG - Intergenic
1112406965 13:99129818-99129840 TGGGCTGAGGAGGAGGAGGAAGG + Intergenic
1113088419 13:106592236-106592258 TAGGCCAAGGAGGAGGAGGAGGG - Intergenic
1113403629 13:110018474-110018496 CATTGGAAGGAGGAGGAGGAGGG - Intergenic
1114441129 14:22748902-22748924 CTGTCAAAGGAGAAGGGGCACGG + Intergenic
1114631764 14:24163866-24163888 CTGTGTCCGCAGGAGGAGGAGGG + Exonic
1114832632 14:26163778-26163800 CTCTCTAAAGAGGAGGGGAAAGG - Intergenic
1115094535 14:29618964-29618986 CTGGAGAATGAGGAGGAGGAAGG + Intronic
1115369829 14:32600754-32600776 GTGTCTGTGGAGGATGAGGAAGG + Exonic
1115688505 14:35821277-35821299 AAGGCTCAGGAGGAGGAGGAGGG + Intergenic
1117920122 14:60720902-60720924 CTGCCAAAGGAGCAGGAGGTAGG + Intronic
1118500389 14:66356844-66356866 TTGTCTGGGGAGGAGGAGGGTGG - Intergenic
1119038252 14:71248795-71248817 CTTTCAAAGGAGGAGGAGGAGGG - Intergenic
1119171077 14:72536875-72536897 AGTTCTAAGGAGGAGGAGGAAGG - Intronic
1119655202 14:76412537-76412559 GTTTGCAAGGAGGAGGAGGATGG - Intronic
1120484852 14:85100230-85100252 GAGGCTAAGGAGGAGGAAGAGGG + Intergenic
1120513037 14:85438482-85438504 GTGTCTGAGAAGAAGGAGGAGGG + Intergenic
1120684698 14:87524660-87524682 CTGTCGAGGGGGCAGGAGGAGGG + Intergenic
1120954003 14:90065670-90065692 CTGTCTGGGGAGGATGAGAAAGG + Intronic
1120990931 14:90376792-90376814 CTGTAAAAAGAGGAGCAGGAAGG - Intergenic
1121696639 14:95918680-95918702 CTGACTCAGGAGGAAGTGGAGGG - Intergenic
1122031665 14:98916691-98916713 CGGTCTATGTAAGAGGAGGAGGG - Intergenic
1122172150 14:99885751-99885773 CAGTGAAAGGAGGAGGAAGAGGG + Intronic
1122873080 14:104650449-104650471 CTGACGACGGGGGAGGAGGAGGG - Intergenic
1123707530 15:22960719-22960741 ATGCCTAAGCAGGAGGAGGGCGG - Intronic
1124696577 15:31869352-31869374 CTGGAGGAGGAGGAGGAGGATGG + Intronic
1124968747 15:34463104-34463126 CTCTCTGAGGGTGAGGAGGATGG + Intergenic
1125069294 15:35532745-35532767 TTTTTTAAAGAGGAGGAGGAAGG + Intronic
1126678917 15:51185537-51185559 CTGTCCTAGGAGGAAGAGGAAGG + Intergenic
1127527993 15:59812996-59813018 TTGTTTAAGGAGGAGGAGACAGG - Intergenic
1127693714 15:61423103-61423125 CTGTCCAGGGAGGAAGAGGCTGG + Intergenic
1128328640 15:66741481-66741503 CTGTAAAATGAGGAGGAGGTGGG + Intronic
1128647253 15:69386909-69386931 CTGACTCAGGAGAAGGAGTAGGG - Intronic
1128765108 15:70246569-70246591 CTGGCAAAGGAGGCGGAGAAGGG - Intergenic
1128856135 15:71018045-71018067 CTGTAAAAGGAGGAGGAGGAGGG + Intronic
1129480542 15:75821674-75821696 CTGTCTATGGAAGAGAAGCAGGG - Intergenic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1130636021 15:85620808-85620830 GTGTCTAAGCAGGATGAGGGCGG + Intronic
1131023750 15:89122169-89122191 CTGGCTAAAGAGGAGTAGGGCGG - Intronic
1131287775 15:91076062-91076084 CTGTCTGAGGCAGAAGAGGAAGG - Intergenic
1131431458 15:92392535-92392557 GTGTGTAAGGAGGGGCAGGAGGG - Intergenic
1131513589 15:93063288-93063310 CGTTCAAAGGAGGTGGAGGAGGG + Intronic
1132141974 15:99404196-99404218 CTGTCTATGAAGAAGGAGCAGGG + Intergenic
1132227707 15:100155321-100155343 CTGTCCAAGAAGGAGGAGAGAGG + Intronic
1132756340 16:1487257-1487279 TGGTCTAAGGAGGAGCTGGAGGG + Intronic
1133075479 16:3277285-3277307 CTGTCCAAGGAGAAAGAGGGGGG + Intronic
1134657302 16:15956797-15956819 GAGGCTAAGGAGGAGGAGGAAGG + Intronic
1135113359 16:19707663-19707685 CTGTGTAGGGAGGTGGGGGAGGG - Intronic
1135381186 16:21997417-21997439 CTGTCAGAGGAGGGGGAGGCAGG + Intronic
1135742041 16:24984270-24984292 CTGTCTAGCAGGGAGGAGGACGG - Intronic
1135747543 16:25029991-25030013 CATTCTCTGGAGGAGGAGGATGG - Intergenic
1136048803 16:27636218-27636240 CTGCCTAGTGGGGAGGAGGATGG - Intronic
1136162790 16:28431662-28431684 CAATTTATGGAGGAGGAGGAAGG - Intergenic
1136200176 16:28683326-28683348 CAATTTATGGAGGAGGAGGAAGG + Intergenic
1136216524 16:28797519-28797541 CAATTTATGGAGGAGGAGGAAGG + Intergenic
1136401816 16:30023413-30023435 CTGTCTTGGGAGCAGCAGGAAGG + Intronic
1136612281 16:31373400-31373422 CTGGGGAAGGAGGAGGAGGCAGG + Intronic
1137608440 16:49802577-49802599 GTGTCACAGGAGGAGGAGGAAGG + Intronic
1137725445 16:50653657-50653679 CCAGCTAAGGAGGAAGAGGAAGG + Intergenic
1137827305 16:51510164-51510186 CTGACAAAGGAGAAGGAAGATGG - Intergenic
1138582495 16:57950761-57950783 CTGTCTCAAGAGGAGAAGGGGGG - Intronic
1139410000 16:66751497-66751519 CTGACCAGTGAGGAGGAGGAAGG - Exonic
1139593622 16:67946337-67946359 GTGTCTGGGGAGGAGGAGCACGG + Exonic
1139946263 16:70644690-70644712 CAGGGTGAGGAGGAGGAGGAGGG + Intronic
1139972615 16:70785672-70785694 CTCAGTGAGGAGGAGGAGGAGGG + Intronic
1141148813 16:81550414-81550436 CTGTCCATGGAGGTGCAGGAGGG + Intronic
1141158519 16:81613235-81613257 CTGATGAAGCAGGAGGAGGAAGG - Intronic
1142749695 17:1979812-1979834 CAGTCAAGGGGGGAGGAGGAGGG - Intronic
1142849128 17:2695855-2695877 CTGCGGGAGGAGGAGGAGGATGG + Intronic
1142915221 17:3131095-3131117 CTGTCTTGGGAGGATGAGGAAGG - Intergenic
1143049202 17:4109411-4109433 CTGTGTGACGAGGAGCAGGAAGG + Intronic
1143951391 17:10635478-10635500 CAGTATGAGGAGGAGCAGGAAGG - Exonic
1144082451 17:11776486-11776508 CTGCCTAAAGAGAAGGAGGTTGG + Intronic
1144229791 17:13190426-13190448 GGGTCCAAGGAGGAGGAGAAAGG + Intergenic
1144414453 17:15033163-15033185 CTCTCTAAAGAGGAGGTGTAAGG + Intergenic
1144472797 17:15559759-15559781 CTGACTGGGGAGGTGGAGGAAGG + Intronic
1144669437 17:17124715-17124737 TTGTCTAGGGAGGTGGAGGTGGG + Intronic
1144673448 17:17146066-17146088 CTGACTAAGCAGTATGAGGACGG + Exonic
1144725515 17:17499987-17500009 CTGTGCAAGCAGGAGCAGGACGG + Intergenic
1144899143 17:18568326-18568348 CGTTCAAAGGAGGTGGAGGAGGG - Intergenic
1144923682 17:18784946-18784968 CTGACTGGGGAGGTGGAGGAAGG - Intronic
1145281897 17:21474152-21474174 CTGTATAAGGAAGAAGAGGGTGG - Intergenic
1145395552 17:22491468-22491490 CTGTATAAGGAAGAAGAGGGTGG + Intergenic
1146364516 17:32210688-32210710 CTGAGGGAGGAGGAGGAGGAGGG + Intronic
1146454576 17:32998923-32998945 CTGAATTAGGTGGAGGAGGATGG - Intergenic
1146460328 17:33041109-33041131 CTGTGTGGGCAGGAGGAGGAGGG - Intronic
1146705124 17:34995750-34995772 CTGTCGGGGGAGGAGGAGGAGGG - Intronic
1147035314 17:37675574-37675596 CAGTCTGGGGAGGAGGAGGCAGG - Intergenic
1147387387 17:40090442-40090464 GTGTGGAAGGAGGAGGTGGATGG - Intronic
1148837637 17:50474268-50474290 GTGTGTAAGGTGGAGGAGGCTGG + Intronic
1149333098 17:55606727-55606749 CTGACGAAGGAAGAGGAGGGAGG - Intergenic
1149430383 17:56592776-56592798 CCGGCCAAGGAGGAGGAGGATGG + Intergenic
1149444776 17:56705114-56705136 CTATCTACAGAGGCGGAGGATGG + Intergenic
1149461356 17:56832687-56832709 GTGTTTAAGAGGGAGGAGGAGGG - Intronic
1149567140 17:57648525-57648547 CTGCCTCAGGAGGAGGAGTCTGG + Intronic
1149604773 17:57916877-57916899 TTCTCTGAGCAGGAGGAGGAGGG + Intronic
1149723639 17:58870113-58870135 CTGGAGGAGGAGGAGGAGGAAGG + Intronic
1150830003 17:68511357-68511379 CTGTCTAAGGAGGAAGAAAAGGG - Intergenic
1151254141 17:72862507-72862529 TTGTCTAAGTAGGAACAGGATGG - Intronic
1151828134 17:76535031-76535053 CTGTCTGAGTGTGAGGAGGAAGG + Intronic
1151867121 17:76811202-76811224 CTGTCTAAGAAGGGGGAGGTGGG + Intergenic
1152011541 17:77721874-77721896 CTGGCTCAGGAGGAGGGGAAGGG + Intergenic
1152127906 17:78458476-78458498 CTGCCTTGGGAGGAAGAGGAGGG - Intronic
1152357642 17:79814565-79814587 CGGTCTCAGGAGGAGGAAGGCGG - Intergenic
1152677659 17:81650056-81650078 CTGTCTAAGGACGAGCTGGCTGG + Intergenic
1153082421 18:1243261-1243283 CTGTCTTTGAAGGTGGAGGAAGG + Intergenic
1153580859 18:6571959-6571981 CTGTCTAGGGAGAAAGATGATGG - Intronic
1153810951 18:8751003-8751025 TGCTCCAAGGAGGAGGAGGATGG + Intronic
1153820449 18:8827170-8827192 GGGTCAGAGGAGGAGGAGGACGG + Intronic
1154162295 18:11989619-11989641 CTGTCTCAGAAGAAGGGGGAGGG + Intronic
1156170211 18:34474020-34474042 CTCTGGAAGGAGGAGGAGTAGGG - Intergenic
1156564151 18:38164508-38164530 CTGTCTCAGGAGGTGGTGGTGGG + Intergenic
1156832960 18:41516872-41516894 CTGTATAAGCAGGAGAAGAATGG - Intergenic
1156841811 18:41617867-41617889 CTGTCTGTGGAGGTGGGGGAAGG - Intergenic
1157030493 18:43900972-43900994 AAGGCTAAGGAAGAGGAGGAAGG - Intergenic
1157776934 18:50403202-50403224 CTCTCTCAGCAGGAGGAGGGGGG - Intergenic
1160480305 18:79233988-79234010 TAGGCTGAGGAGGAGGAGGAAGG + Intronic
1160958831 19:1708187-1708209 CTGGCTGTGGAGGTGGAGGAAGG - Intergenic
1161358775 19:3834469-3834491 GTGACTATGAAGGAGGAGGAGGG - Intronic
1161509544 19:4662919-4662941 CTGGGGTAGGAGGAGGAGGAAGG - Intronic
1161865546 19:6829671-6829693 TTGGCCAAGGAGGAGGAGAAGGG + Intronic
1162877303 19:13630188-13630210 CTGTCCCAGGAGGAAGAGGAGGG + Intergenic
1163690908 19:18737766-18737788 CTGGCTGAGGAGGAGGAAAAGGG - Intronic
1163861784 19:19746773-19746795 CTGTCTGAGGGTGACGAGGACGG - Intergenic
1164473404 19:28554559-28554581 TGGTCTCAGGAGGAGGAGGTAGG - Intergenic
1164640752 19:29823783-29823805 CTGTCTTTGGTGGAGAAGGATGG - Exonic
1164664726 19:30020444-30020466 CTGTCTTAGGATGAGGGTGAAGG - Intergenic
1164695638 19:30241579-30241601 CTGTCTAAGGAGCAGCAGTGTGG + Intronic
1164800087 19:31068957-31068979 CTGCCAGGGGAGGAGGAGGAAGG - Intergenic
1165272772 19:34724775-34724797 CTCTCTCAGCAGGAGGAGGGGGG - Intergenic
1165427298 19:35753236-35753258 CTGCCTGAGGATGAGGAGGTGGG + Exonic
1165730792 19:38143370-38143392 CACTGCAAGGAGGAGGAGGAAGG - Intronic
1166288150 19:41845145-41845167 CCGGCTAAGAGGGAGGAGGACGG - Intronic
1167114893 19:47483456-47483478 GTGTGTAAGGAGGAGGGCGAAGG + Intronic
1167139051 19:47636976-47636998 TTGACTAAGGAGGGGAAGGAGGG - Intronic
1167299546 19:48670948-48670970 CTGGCCCAGGAGGAGCAGGAGGG + Exonic
1167448894 19:49555929-49555951 CTGGCTAAGGAGTAGGAGTTGGG + Intronic
1167474543 19:49692144-49692166 CTGGGTATGAAGGAGGAGGAGGG + Intronic
1167509503 19:49888589-49888611 CTGCCCGAGGAGGAGGACGAGGG + Exonic
1168107021 19:54171975-54171997 CTGGAGGAGGAGGAGGAGGATGG - Exonic
1168271849 19:55254449-55254471 CTGTCCAAGCAGGGGAAGGAAGG - Intronic
925190714 2:1881137-1881159 CTGTGAGAGGAGGAGGAGGCAGG + Intronic
925263352 2:2546985-2547007 CTGCCCGAGGATGAGGAGGATGG + Intergenic
925902094 2:8515957-8515979 CTGTGTGGGGAGGTGGAGGAGGG - Intergenic
926084013 2:10009901-10009923 CTTTCCAAGCAGGAGGAGGGAGG + Intergenic
926321215 2:11749445-11749467 CTGTGGAAAGAGGAAGAGGAAGG - Intronic
926734085 2:16059258-16059280 AGGTCTAGGGAAGAGGAGGAGGG - Intergenic
927190929 2:20516449-20516471 TTGTCTAAGGAAGAGGGGGCTGG - Intergenic
928098975 2:28423751-28423773 CTGTCAAATCAGGAGAAGGAGGG - Intergenic
928099432 2:28427317-28427339 CTGAGGAAGGAGGAGGAGAAGGG - Intergenic
928904855 2:36357158-36357180 TTATCTGCGGAGGAGGAGGAAGG - Intronic
929546788 2:42861122-42861144 CTTCCTTAGGAGGACGAGGACGG + Intergenic
931236180 2:60414143-60414165 TTGGCAAAGGAGGAGGGGGAAGG - Intergenic
931459842 2:62441104-62441126 CTGTCCCAGGAGGAGAAGGATGG + Intergenic
932625925 2:73295866-73295888 CTGCCTGAGAGGGAGGAGGAGGG + Intergenic
933505830 2:83176129-83176151 TTGGATAAGGAGGAGGAAGAGGG - Intergenic
933981801 2:87556472-87556494 CTGCCAAGGGAGGAGGAGGGAGG + Intergenic
934736285 2:96691448-96691470 CTGGCCAAGGGCGAGGAGGAGGG + Intergenic
935687846 2:105699913-105699935 GTGTTTGAGGAGGAGAAGGAAGG - Intergenic
936312035 2:111394345-111394367 CTGCCAAGGGAGGAGGAGGGAGG - Intergenic
937111847 2:119372700-119372722 CTTTGTGGGGAGGAGGAGGATGG + Intergenic
937969108 2:127536033-127536055 GGGGCTGAGGAGGAGGAGGAGGG + Intronic
938099708 2:128490439-128490461 CAGGCAAAGGAGAAGGAGGAAGG + Intergenic
938221942 2:129576573-129576595 CTTGCAGAGGAGGAGGAGGAGGG - Intergenic
940426437 2:153536385-153536407 CTGTCCAATCTGGAGGAGGAGGG + Intergenic
940987383 2:160062669-160062691 TTGGGGAAGGAGGAGGAGGAGGG + Intergenic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942306393 2:174611499-174611521 TGGTATCAGGAGGAGGAGGAGGG + Intronic
943218704 2:185075782-185075804 ATGTAGAATGAGGAGGAGGAGGG + Intergenic
944084854 2:195833958-195833980 CTGTCTTAGGAGGCCAAGGAAGG + Intronic
944098342 2:195994933-195994955 CTGTCTAAAGAAAAGGAAGAAGG - Intronic
944186825 2:196958172-196958194 TTGGCTAAGGAGAAGAAGGAAGG - Intergenic
944537483 2:200725458-200725480 CTGTCAAAGGGTGAGGGGGAGGG - Intergenic
945159384 2:206873692-206873714 CTGTTTAAAGAGAAAGAGGATGG + Intergenic
946200609 2:218068821-218068843 CTGACTGAGGTGGAGAAGGAAGG + Intronic
946602889 2:221371467-221371489 CTGGCGACGGAGCAGGAGGAAGG - Intergenic
946629676 2:221653437-221653459 CTGTCAAGGGAGGAGGAGTCAGG + Intergenic
946632672 2:221687679-221687701 CTGTCTCTGGGGGATGAGGAAGG + Intergenic
946689600 2:222300376-222300398 CTGTCAAAGGAGGTGGGGGAGGG - Intronic
946740106 2:222792868-222792890 GTGAAGAAGGAGGAGGAGGAGGG - Intergenic
947235374 2:227935926-227935948 TTGCTTAAGGAGGAAGAGGAGGG + Intergenic
947901095 2:233722941-233722963 TGGGCTGAGGAGGAGGAGGAAGG + Intronic
948056527 2:235012813-235012835 TGGTCCAAGGAGCAGGAGGAAGG + Intronic
948194642 2:236086087-236086109 ATCTCTAAGCAGGAGGAGGGGGG - Intronic
948229739 2:236341357-236341379 CTCTCCTAGGAGGAGGAGAAAGG + Intronic
948697620 2:239741006-239741028 ATCTCAAAGGAGGAGGAGGCTGG + Intergenic
948995445 2:241576064-241576086 CTGGCAGGGGAGGAGGAGGAGGG - Intergenic
949028261 2:241776383-241776405 CAGGCTCAGGAGGAGGAGGAGGG + Intergenic
1170006457 20:11675132-11675154 CACTCTGAGGAGGAGGAGGAAGG - Intergenic
1170602436 20:17851130-17851152 TGGGCTGAGGAGGAGGAGGAAGG + Intergenic
1171040319 20:21756829-21756851 TAGGCTGAGGAGGAGGAGGAAGG + Intergenic
1171161388 20:22927288-22927310 TAGGCTGAGGAGGAGGAGGAAGG - Intergenic
1171201838 20:23247945-23247967 CTGTGAAAGGAGGAGGGGGACGG + Intergenic
1171327266 20:24305569-24305591 GGGTTGAAGGAGGAGGAGGAAGG + Intergenic
1172044969 20:32073827-32073849 CTGTCTTAGGGGGAGTGGGATGG - Intronic
1172423958 20:34842391-34842413 CTGTGAAAGGAGGGGAAGGAAGG + Intergenic
1172779073 20:37425087-37425109 CTGGGTAAAGGGGAGGAGGAGGG - Intergenic
1173853029 20:46230940-46230962 CTGCCTTAGAGGGAGGAGGAGGG + Intronic
1173920996 20:46744487-46744509 GTGGCAGAGGAGGAGGAGGATGG + Intergenic
1174092588 20:48061074-48061096 CTGGCTAAGGAGGAGGGGAATGG - Intergenic
1174339624 20:49887720-49887742 GTGTCTAGGGAGGAGGTGGGAGG - Intronic
1174485620 20:50859461-50859483 GTGTCTGAGGAGGAGGAGACAGG + Intronic
1174549858 20:51354636-51354658 CTCTTTAAGGAGCATGAGGAAGG - Intergenic
1175100534 20:56575827-56575849 GGGTTTAGGGAGGAGGAGGAGGG - Intergenic
1176233775 20:64044905-64044927 CTGACTCAGCAGGAGGAGGGTGG + Intronic
1176362059 21:6006177-6006199 CTCCAAAAGGAGGAGGAGGAGGG + Intergenic
1176728532 21:10465763-10465785 TTTTCTAGGGAGGAGGTGGAGGG + Intergenic
1177648967 21:23936584-23936606 TTGTCTAAGAAGGAGGATCAGGG - Intergenic
1178719816 21:34998417-34998439 TTCTCTGAGGAGGAGGATGAAGG - Intronic
1178816405 21:35933963-35933985 CTGACTTAGAAGGAGAAGGAAGG + Intronic
1178881747 21:36455451-36455473 CTGTGGAAGGAGGGTGAGGATGG + Intergenic
1179182490 21:39057629-39057651 CTGGCTTTGAAGGAGGAGGAAGG - Intergenic
1179554498 21:42163590-42163612 CTGGATGAGGGGGAGGAGGAGGG + Intergenic
1179585026 21:42369358-42369380 CTGTCTAGGAAGGAGGAAGCAGG + Intergenic
1179761459 21:43532368-43532390 CTCCAAAAGGAGGAGGAGGAGGG - Intronic
1180754670 22:18152700-18152722 AGGTCTAAGGAGGATGGGGAGGG - Intronic
1180792506 22:18583697-18583719 CTGATTAGGGTGGAGGAGGAGGG - Intergenic
1180919143 22:19510533-19510555 CTGTCTCAGGTGGCGGACGAGGG - Intronic
1181229231 22:21411618-21411640 CTGATTAGGGTGGAGGAGGAGGG + Intergenic
1181249420 22:21523245-21523267 CTGATTAGGGTGGAGGAGGAGGG - Intergenic
1182133217 22:27874423-27874445 CTGTCAAAGGAGGCGAAGGAGGG + Intronic
1182319601 22:29470157-29470179 ATGTCTGGGGAGGAGGAGAAGGG + Intergenic
1182469148 22:30536691-30536713 TTGAACAAGGAGGAGGAGGAGGG + Intronic
1182671127 22:31996896-31996918 CTGGCCAGGGAAGAGGAGGAAGG + Intergenic
1182774210 22:32818972-32818994 GTGTCAGAGGAGGAGGAGGCAGG - Intronic
1182804983 22:33061810-33061832 ATGTCTAAGGTGGAGGAGATAGG - Intergenic
1183630827 22:39031671-39031693 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183634343 22:39052051-39052073 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1184048187 22:41985289-41985311 CTGTGAGAGGAGGAGGAGGCTGG - Intronic
1184418293 22:44364561-44364583 CTGCTTAAGGAGAAGGATGAGGG + Intergenic
1185339811 22:50286250-50286272 TCGTCTAAGGAGGAGCTGGATGG + Exonic
949152888 3:791695-791717 CTGTCTGGGGCGGAGGAGGGTGG + Intergenic
950096637 3:10334483-10334505 TGGTCTAAAGGGGAGGAGGATGG + Intronic
950459210 3:13111255-13111277 CTCTCTAATGAGAAGCAGGAAGG - Intergenic
950618090 3:14178465-14178487 CGGCGTGAGGAGGAGGAGGAGGG - Exonic
950861143 3:16148607-16148629 CAGTCTCAGGAGGACAAGGAGGG - Intergenic
951185352 3:19706206-19706228 CTAGTTAAGGAGGAAGAGGAAGG + Intergenic
951393970 3:22141663-22141685 CTGGGGGAGGAGGAGGAGGAGGG + Intronic
951941137 3:28079998-28080020 CTGGCTAGGCAGGAAGAGGAAGG - Intergenic
952464302 3:33565059-33565081 TAGGCTAAGGAGGAAGAGGAGGG - Intronic
952614168 3:35249457-35249479 CAGTCTAAGCAAGAGAAGGAGGG - Intergenic
952711890 3:36439940-36439962 CTGTCAAAGAAGGGGGAAGAAGG - Intronic
952960439 3:38586042-38586064 CTGGGGAAGGAGGAAGAGGAGGG + Intronic
953054990 3:39380973-39380995 CTGTCAGAGCAGGAGGAGGTGGG - Intergenic
953405727 3:42658917-42658939 TTCTTTAAGGAGGAGAAGGAGGG + Exonic
953702474 3:45207371-45207393 CTCTCTAAGGAAGAGGAAGGTGG + Intergenic
953767984 3:45758842-45758864 GTGTCTAAAGAAGATGAGGAAGG - Exonic
954130579 3:48558715-48558737 CTGCAAAAGGAGGATGAGGAAGG - Intronic
954594743 3:51814708-51814730 CTGCTTTAGGAGGAGGAGGAGGG - Intergenic
955850996 3:63219785-63219807 TAGACTGAGGAGGAGGAGGAAGG + Intergenic
956536242 3:70280222-70280244 CTTTTTAAGGGAGAGGAGGAGGG - Intergenic
956975148 3:74570206-74570228 ATGTATATGGAGGGGGAGGAGGG + Intergenic
957165587 3:76668899-76668921 CTTTCTTTGGAGGAAGAGGATGG + Intronic
957360995 3:79157450-79157472 CTGTCTAAGGATGTGTTGGAAGG + Intronic
957772185 3:84708045-84708067 CTGTTTAAGGAGGAAGAGGCGGG - Intergenic
958981780 3:100728925-100728947 CTTTTTAAGTAGGAGAAGGATGG + Intronic
959895898 3:111605589-111605611 ATCTCTGAGGAGGTGGAGGACGG - Intronic
959963810 3:112332213-112332235 AAGACGAAGGAGGAGGAGGAGGG + Intergenic
960673765 3:120175700-120175722 CTGGCTTAGAAGGTGGAGGAGGG + Intronic
960761865 3:121080623-121080645 TTGTTTAAGGAGGTGGAAGATGG + Intronic
961379980 3:126490746-126490768 CTGACTAAAGAGAAGGAGTAGGG + Intronic
961646490 3:128395420-128395442 CATTCAGAGGAGGAGGAGGAAGG - Intronic
961763543 3:129189874-129189896 CTTTGGAAGGTGGAGGAGGATGG - Intergenic
962883896 3:139605209-139605231 ATGAATAAGGATGAGGAGGAAGG - Intronic
963437557 3:145289974-145289996 CTGTCTATGGAGTAGGGTGATGG + Intergenic
964441716 3:156718169-156718191 TAGGCTGAGGAGGAGGAGGAAGG + Intergenic
965311680 3:167135923-167135945 TTGTTTAAGGAGGAGAGGGAAGG + Intergenic
966430409 3:179826245-179826267 CTGGGTAAGGAGGAAGAGAAAGG - Intronic
966571690 3:181451263-181451285 CTGTCTAAAAAGGAGAAAGAGGG + Intergenic
966951228 3:184819992-184820014 TAGGCTGAGGAGGAGGAGGAGGG + Intronic
966968419 3:185019073-185019095 CACTCTAATGATGAGGAGGAAGG - Intronic
967258905 3:187622414-187622436 CTGTCTAGGGAGATGGAGGATGG - Intergenic
968075825 3:195815767-195815789 CTGTGTAAGAAGAAGGAGGCCGG - Intergenic
968075836 3:195815812-195815834 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075848 3:195815857-195815879 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075860 3:195815902-195815924 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075872 3:195815947-195815969 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075897 3:195816037-195816059 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075909 3:195816082-195816104 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075921 3:195816127-195816149 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075933 3:195816172-195816194 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075945 3:195816217-195816239 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075957 3:195816262-195816284 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968075969 3:195816307-195816329 CTGTGTAAGGAAAAGGAGGCCGG - Intergenic
968076095 3:195816780-195816802 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076131 3:195816908-195816930 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076144 3:195816953-195816975 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076195 3:195817125-195817147 CTGCATAAGGAGAAGGAGGCCGG - Intergenic
968076231 3:195817253-195817275 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076293 3:195817475-195817497 CTGTGTAAGGAGAACGAGGCCGG - Intergenic
968076318 3:195817564-195817586 CTGCTTAAGGAGAAGGAGGCCGG - Intergenic
968078175 3:195828304-195828326 CCAACTGAGGAGGAGGAGGAGGG + Intergenic
968161611 3:196431962-196431984 ATGATGAAGGAGGAGGAGGAGGG + Intronic
968239484 3:197064032-197064054 CTGGCTAAGGAGGCTGAGGCAGG - Intronic
968332702 3:197885179-197885201 ATGTCTGAGGAGCAGCAGGAGGG - Intronic
969497611 4:7535027-7535049 GTGTGTCAGCAGGAGGAGGAGGG - Intronic
970113926 4:12671431-12671453 TTGGCTGAGGAGGAGGAGGAGGG + Intergenic
970224080 4:13839070-13839092 CTGGCTTAGAAGGCGGAGGAAGG - Intergenic
970326833 4:14934513-14934535 CAGGCTGAGGAGGAGGAGGACGG + Intergenic
970539794 4:17065982-17066004 CTATCTGAGCAGGAGAAGGATGG + Intergenic
970802572 4:19991488-19991510 GAGACTAAGGAGGATGAGGAGGG - Intergenic
970827308 4:20291367-20291389 TTGGCTGAGGAGGAGGAGAATGG + Intronic
970852535 4:20618170-20618192 CAGACAAAGGAGAAGGAGGAAGG - Intronic
971323359 4:25623307-25623329 CAGCCTCTGGAGGAGGAGGAGGG - Intergenic
972233275 4:37099849-37099871 CTGACTATGAAGGTGGAGGAAGG + Intergenic
973229315 4:47823857-47823879 GGGTCTGAGTAGGAGGAGGAAGG - Intronic
973303585 4:48617630-48617652 GTGTTAAAAGAGGAGGAGGAGGG + Intronic
975329571 4:73099089-73099111 CTGGAGAAGGAGGAAGAGGAGGG + Intronic
975495415 4:75030890-75030912 ATGTAAGAGGAGGAGGAGGAGGG + Intronic
975712940 4:77178660-77178682 CTGTGGAAGGAGAAGGAAGAGGG + Intronic
977360537 4:95998890-95998912 ATGTCTAGGGGGGAGGGGGAAGG + Intergenic
977609863 4:99020537-99020559 CTGCCTGAGGAGGAGGAGGCGGG + Intronic
978957696 4:114634425-114634447 CTCTCCAAGGAAGAGGAGGAGGG + Intronic
979230621 4:118345324-118345346 ATTTGTAAGAAGGAGGAGGAGGG + Intronic
980714228 4:136611178-136611200 CAGGCTAAGGAGGAAGAGGGAGG - Intergenic
981041637 4:140228244-140228266 ATGAAGAAGGAGGAGGAGGAGGG - Intergenic
981295430 4:143125856-143125878 CTCTGGAAGGTGGAGGAGGAAGG - Intergenic
981491723 4:145346864-145346886 CTGTCTAAGTGGGTGCAGGACGG - Intergenic
981594020 4:146398905-146398927 CTGTGTAAGCAGCAGGAGAACGG + Intronic
982116616 4:152103731-152103753 CTGGGGCAGGAGGAGGAGGAGGG - Intergenic
982206993 4:153004295-153004317 GTGTGTGGGGAGGAGGAGGAAGG + Intergenic
983002737 4:162438594-162438616 CAATCTCAGGAGGAGAAGGAGGG - Intergenic
983589337 4:169390392-169390414 TAGGCTGAGGAGGAGGAGGAAGG + Intergenic
983650079 4:170028348-170028370 CTGTCTAAGGAGGAGGAGGATGG + Intronic
983734995 4:171046158-171046180 CTCTCTAAGGAGGAGTAAGAAGG - Intergenic
986205151 5:5617186-5617208 CTGTCTCTGGAGGTGGAGGCAGG - Intergenic
986468506 5:8050689-8050711 CTGTATAAGAAGGAGAAGGAAGG + Intergenic
986806535 5:11313228-11313250 CTGCTCAGGGAGGAGGAGGAGGG - Intronic
987996219 5:25283814-25283836 CTATCTATGGAGGCAGAGGAGGG + Intergenic
990174050 5:53087380-53087402 TTGTGTAAGCAGGAGGAGAAAGG - Intronic
990368717 5:55095304-55095326 CTATCTGAGGACAAGGAGGAGGG - Intergenic
990392972 5:55346329-55346351 GTTTCTATGGAGGAGGAGTACGG - Intronic
990432518 5:55750436-55750458 TATTCTCAGGAGGAGGAGGAGGG + Intronic
990526975 5:56637648-56637670 ATGGCTTTGGAGGAGGAGGAGGG + Intergenic
991019579 5:61965870-61965892 CTGTCAGAGGAGTAGGATGAGGG + Intergenic
991960058 5:72035354-72035376 CTTTGAAAGAAGGAGGAGGAGGG - Intergenic
992278567 5:75148341-75148363 CTCCATAAAGAGGAGGAGGAAGG + Intronic
995222713 5:109668902-109668924 CTATCTAAGGAACAGGGGGAAGG - Intergenic
997356944 5:133268608-133268630 CTGTCTCAGGATGAGCAGGAAGG - Intronic
997682032 5:135763527-135763549 TATTCTATGGAGGAGGAGGAGGG + Intergenic
998199428 5:140107864-140107886 CAGGGGAAGGAGGAGGAGGAGGG + Intronic
999152981 5:149438761-149438783 CTCTCTAAGGAGGGAGATGATGG - Intergenic
999498038 5:152119442-152119464 CTGTGTCAGGAGCAGGTGGAGGG + Intergenic
999880069 5:155852559-155852581 ATGTCAAAGAAGTAGGAGGATGG + Intergenic
1001562473 5:172678481-172678503 CTGGCTGAGGAGCAGGAGGTGGG - Intronic
1002351763 5:178588947-178588969 CTATCCCAGGAGAAGGAGGAAGG + Intronic
1002705832 5:181160485-181160507 CTGTTTCAGGAGGCGAAGGAAGG + Intergenic
1003101206 6:3177664-3177686 TTGACTATGGAGGAGGAGGTAGG + Intergenic
1003113878 6:3270503-3270525 CAGCCTGAGGAGGAGGAGGCCGG - Exonic
1003285667 6:4731889-4731911 CTGTGGAAGGAGGGGGAAGATGG + Intronic
1003493401 6:6642863-6642885 TCGTCTCCGGAGGAGGAGGAGGG - Intronic
1003707939 6:8555681-8555703 CTCTGTAAGGAGGAGGTGGAGGG - Intergenic
1003965603 6:11249620-11249642 ATGACTAAGGAAGAGGAGAATGG + Intronic
1004327530 6:14689204-14689226 GTGTCACAGGAGGAAGAGGAAGG + Intergenic
1004829178 6:19458805-19458827 TTTTTAAAGGAGGAGGAGGAAGG + Intergenic
1005009569 6:21322976-21322998 TTTTCTGAGGAGGAGGAGGGAGG + Intergenic
1005500138 6:26422159-26422181 CAGGCTGAGGAGGAGGAGGAGGG - Intergenic
1005654429 6:27919534-27919556 CAGTATCAGGAGGAGAAGGAGGG + Intergenic
1005912931 6:30326785-30326807 CTGCGGAAGAAGGAGGAGGAGGG - Intronic
1006196118 6:32243580-32243602 CTGTCCAGGGGGGTGGAGGAAGG + Intergenic
1007208096 6:40169173-40169195 AAGTTTAAGGAGGAAGAGGATGG - Intergenic
1007325856 6:41059036-41059058 TTGCCTAGGGAAGAGGAGGAGGG + Intronic
1007509841 6:42366477-42366499 CACTCTAACGGGGAGGAGGATGG + Intronic
1007870683 6:45034145-45034167 CTGTTGGAGGAGGAGGAGGTAGG - Intronic
1007954350 6:45902650-45902672 CTTTCTAAGAAGGATGAAGATGG + Exonic
1008326379 6:50187255-50187277 CTGTCTTGTGAGGAGGATGATGG - Intergenic
1009820987 6:68800875-68800897 CTATCTAAATGGGAGGAGGAAGG + Intronic
1010307908 6:74346271-74346293 CTTTCTAAGAAAGAGGAAGAAGG + Intergenic
1010538346 6:77059835-77059857 GTGGCTAAGGAGGAAGAGAAGGG - Intergenic
1011735613 6:90308115-90308137 CTTTTTAAGAGGGAGGAGGAGGG - Intergenic
1013301208 6:108806282-108806304 GTGTCTGAGGCAGAGGAGGAGGG - Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013425394 6:110008008-110008030 CCATCCAAGGAGGATGAGGATGG - Intergenic
1014002538 6:116380937-116380959 CTGGCTAAGGTGAAGAAGGAAGG - Intronic
1014116753 6:117675487-117675509 CTGCCAAGGGAGGAGGAAGATGG + Exonic
1014268976 6:119314655-119314677 CTGTGCATGGAGGAGCAGGAGGG - Intronic
1014820395 6:125982795-125982817 CTGCCTGAGGAAAAGGAGGATGG - Intergenic
1015414262 6:132930881-132930903 CTGTCTGAGCAGCAGGAGGGAGG + Intergenic
1016005007 6:139080173-139080195 CTTTCTAATCAGAAGGAGGAGGG + Intergenic
1016073877 6:139773691-139773713 GTGTCTAATGAGGATAAGGATGG - Intergenic
1016166061 6:140945122-140945144 CTGTGAAAGCAGCAGGAGGAAGG + Intergenic
1016556976 6:145349787-145349809 CTGTCTGAAGAGAAGCAGGATGG + Intergenic
1016767575 6:147812018-147812040 CTGCCTAAAGAGGCAGAGGAGGG + Intergenic
1016985356 6:149890772-149890794 CTGGCTGAGGACAAGGAGGAGGG - Intronic
1018220205 6:161570501-161570523 GTGGCTGAGGAGGAGGAGGAGGG - Intronic
1018380495 6:163254309-163254331 CTGATGAAGGGGGAGGAGGATGG + Intronic
1018638291 6:165884046-165884068 ATGTCAAAGCAGGTGGAGGAAGG + Intronic
1019126398 6:169843265-169843287 GTGGCTAATGAGGAGAAGGATGG - Intergenic
1019869267 7:3743702-3743724 ATGTCGGAGGAGGAGGAAGAGGG + Intronic
1019961186 7:4461325-4461347 CTTTCTCTGGAGGAGGAGGGGGG - Intergenic
1020438415 7:8190353-8190375 CTCTCTGAGGAGGCAGAGGAAGG - Intronic
1021189530 7:17603552-17603574 CCCTCTATGGAGGAGGAGAAAGG + Intergenic
1022417246 7:30188924-30188946 CTTTCCCAGGAGGAGGAGGGAGG + Intergenic
1023055578 7:36287299-36287321 CTATATAAGAAGGAGGTGGAAGG - Intronic
1023951183 7:44847678-44847700 CCGTCTTAGAAGGAGGAGGACGG - Intronic
1024387810 7:48773613-48773635 CTGTCACAGGAGAAAGAGGATGG - Intergenic
1024677254 7:51647779-51647801 TTGGATGAGGAGGAGGAGGAAGG - Intergenic
1026176324 7:68000981-68001003 GAGGCTGAGGAGGAGGAGGAAGG + Intergenic
1027251038 7:76398857-76398879 GTGTTTAAGGGGCAGGAGGATGG + Intronic
1028534782 7:91880541-91880563 TTGTCTTTGGAGGAGGAAGAGGG - Intronic
1028714982 7:93955437-93955459 CAGTCTCAGGAGGACGAGAAGGG + Intergenic
1028762291 7:94509782-94509804 GAGGCTAAAGAGGAGGAGGAAGG + Exonic
1028955149 7:96681000-96681022 CTGACTTAAGAGGATGAGGAGGG + Intronic
1029537174 7:101163612-101163634 CTGTTCGCGGAGGAGGAGGACGG - Exonic
1029548070 7:101221830-101221852 AGGTCCAAGGAGGAGGAGGAAGG + Intronic
1029745718 7:102514757-102514779 CTGTGGAAGGAGGAGGACCAGGG + Intronic
1029763657 7:102613736-102613758 CTGTGGAAGGAGGAGGATCAGGG + Intronic
1030059106 7:105608952-105608974 GTGTCTAGGGAGGACCAGGAAGG - Intronic
1030898910 7:115097266-115097288 CTCTCTCAGGAGGATCAGGACGG - Intergenic
1031458143 7:122010325-122010347 TTTTCAAAGGAGGAGGAAGAGGG + Exonic
1031677629 7:124631166-124631188 CTTTCTAAGGAGGAGAAGCTTGG - Intergenic
1031713774 7:125081434-125081456 CTGTCTAAGAACGCAGAGGAAGG - Intergenic
1031994561 7:128221050-128221072 CTCACAAAGAAGGAGGAGGAGGG - Intergenic
1032056348 7:128687691-128687713 CTGTCTCTGGAGGAGGAGACAGG + Intergenic
1032432283 7:131871791-131871813 CTGTCTGTGGAGGAGGTGGTGGG + Intergenic
1032634569 7:133692800-133692822 AATTCTAAGGAGGAGGAGAAAGG - Intronic
1033023704 7:137752962-137752984 CTGTCTAGGAAGGATGAGTAGGG - Intronic
1033706842 7:143897281-143897303 TAGGCTAAGGATGAGGAGGAAGG - Intronic
1034248609 7:149670048-149670070 CAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1034421297 7:150992458-150992480 CTGTCTCAGGAGGAGGGAGATGG - Intronic
1034673905 7:152877953-152877975 CTTTCTGAGGTGGAGGAGGTTGG + Intergenic
1034746018 7:153524512-153524534 CTCTCCAAGGAGGAGGTGGAGGG + Intergenic
1034970985 7:155418959-155418981 CTCTGTGAGGAGGTGGAGGAAGG + Intergenic
1035194677 7:157206823-157206845 CTGTGAAAGCAGGAGCAGGATGG + Intronic
1035551784 8:533583-533605 CTGTTTAAGGAGGAGGGGTTGGG - Intronic
1035581426 8:741959-741981 CTGTCTGTGGAGGAGAAGGGCGG + Intergenic
1036039647 8:5060994-5061016 CTGAGCAAGGAGGAAGAGGAAGG - Intergenic
1036295217 8:7529242-7529264 CTGGAGAAGGAGGAGGAGAAGGG - Intergenic
1036327353 8:7791776-7791798 CTGGAGAAGGAGGAGGAGAAGGG + Intergenic
1036521684 8:9497769-9497791 CTAAAGAAGGAGGAGGAGGAAGG - Intergenic
1036621229 8:10425433-10425455 CTGCGAAGGGAGGAGGAGGAGGG + Intronic
1036767263 8:11556884-11556906 CGGGCTTAGCAGGAGGAGGAGGG + Intronic
1037908095 8:22727298-22727320 CTCTCTCTGCAGGAGGAGGATGG + Intronic
1037909542 8:22735704-22735726 CTGTCAAGAGAGGAGGAGGGTGG + Intronic
1038040122 8:23717217-23717239 CTGTCTGGGGAGGAGGTAGAAGG - Intergenic
1038624929 8:29182501-29182523 CAGCCTAAGGGGGCGGAGGAGGG + Intronic
1038699595 8:29837176-29837198 GAGTCTAAGTATGAGGAGGAAGG + Intergenic
1038740561 8:30213135-30213157 CTGTCTCAGAGGGAGGAGCAGGG + Intergenic
1038923812 8:32115544-32115566 GTAGCTGAGGAGGAGGAGGAAGG + Intronic
1039347047 8:36716668-36716690 GTGATTCAGGAGGAGGAGGAAGG - Intergenic
1039597806 8:38806529-38806551 CTGTCTTGGGAGGAGAAAGAGGG + Intronic
1041021650 8:53644085-53644107 CTGTCTCAGCAGGTGAAGGAAGG - Intergenic
1041643718 8:60229790-60229812 ATGTCTAGGCAGGAGGGGGAAGG - Intronic
1041860567 8:62508350-62508372 ATGTCCAAGGTGGAGGGGGAGGG - Intronic
1042815576 8:72874729-72874751 TTGTGTCAGGAGCAGGAGGAGGG + Intronic
1042833155 8:73053434-73053456 ATGGGGAAGGAGGAGGAGGAGGG - Intergenic
1043499505 8:80838670-80838692 CTGGAGGAGGAGGAGGAGGAGGG + Intronic
1044727582 8:95205760-95205782 CTGTATAAGGATAGGGAGGATGG + Intergenic
1044968974 8:97601552-97601574 CTGTCAAAGGGAGAGGAGGTCGG + Intergenic
1044986602 8:97761509-97761531 GTGTCAAAGGTGGAGAAGGAAGG - Intergenic
1045535261 8:103021409-103021431 GTCTCTAAGGAAGAGAAGGAGGG + Intronic
1045785435 8:105915839-105915861 CTGTGTAAGGAGGGTGAGAAGGG - Intergenic
1046109110 8:109700354-109700376 TTGGCTGAGAAGGAGGAGGAGGG - Intergenic
1047614918 8:126556280-126556302 CTGTGGACGGGGGAGGAGGAAGG - Exonic
1048951530 8:139500876-139500898 TTGTGAATGGAGGAGGAGGAAGG + Intergenic
1049230675 8:141479644-141479666 GTGTTTAAGAAGGAGGAGGAGGG + Intergenic
1050053881 9:1631781-1631803 CTGTTTTAGGAGGAGGAGTTGGG - Intergenic
1050275398 9:3992453-3992475 CTGTTTATGCATGAGGAGGAAGG - Intronic
1050751054 9:8937702-8937724 TTTTGTAAGAAGGAGGAGGAAGG - Intronic
1050957821 9:11687253-11687275 CTGCCCAAGGAGGAGTAGCAGGG + Intergenic
1051414585 9:16825608-16825630 CTTCCTGGGGAGGAGGAGGAGGG + Intronic
1051666978 9:19474823-19474845 ATTGATAAGGAGGAGGAGGAGGG - Intergenic
1055266071 9:74497565-74497587 TGGACTGAGGAGGAGGAGGAAGG - Exonic
1055599560 9:77901519-77901541 CGGCCTAAGGAGGAAGAGGCAGG - Intronic
1055723123 9:79197909-79197931 CAGGATGAGGAGGAGGAGGAAGG - Intergenic
1055789638 9:79910130-79910152 CTGCCCAAGGGAGAGGAGGAGGG + Intergenic
1056512831 9:87321875-87321897 TGGTCTATGGAGTAGGAGGAAGG - Intergenic
1056564835 9:87761908-87761930 GTGTTTCAGGAGGAGGAGGTAGG + Intergenic
1056761129 9:89415620-89415642 CTGTCTATGAACCAGGAGGAGGG + Intronic
1056992843 9:91426525-91426547 GGTTCTCAGGAGGAGGAGGAAGG + Intergenic
1057920886 9:99095656-99095678 CTGTGTAATGGGGAGGGGGAAGG - Intergenic
1058171547 9:101687048-101687070 CTGGGTAAGGAGGAGGAAGTCGG + Exonic
1058969147 9:110064205-110064227 CTACCTAAGGAGGAGGAGGAAGG + Intronic
1060301166 9:122375375-122375397 CTGTCTGAGGTGGAGCCGGAAGG - Intronic
1060354166 9:122888543-122888565 CTTTCTAAGTAAGAGAAGGAGGG - Intronic
1060552830 9:124493685-124493707 CAGGCTCAGGAGGAGGAGGGAGG + Intronic
1060776310 9:126377190-126377212 GTCTCTGAGGAGGAGCAGGAGGG - Intronic
1060979831 9:127785707-127785729 CCGTCGGAGGAGGAGGAGCAGGG + Intronic
1061671409 9:132190520-132190542 CTGACTAAGGAGGCCGTGGAGGG - Intronic
1061836909 9:133335610-133335632 CGGTGTGGGGAGGAGGAGGATGG - Intronic
1062068500 9:134541633-134541655 CTGTGTCATGAGGATGAGGAGGG + Intergenic
1062212923 9:135374183-135374205 CTGTGGAAGTAGGTGGAGGAGGG - Intergenic
1062402125 9:136377399-136377421 GTGTCTTAGGAGGAGGAAGCTGG - Intronic
1062578968 9:137221407-137221429 CAGTCCTGGGAGGAGGAGGAAGG + Intronic
1203772083 EBV:54557-54579 CCGCCAAAGAAGGAGGAGGAGGG - Intergenic
1185504972 X:625227-625249 GAGTAGAAGGAGGAGGAGGAGGG - Intronic
1185550651 X:980746-980768 GTGTCCATGGAGGAGGAGGAGGG + Intergenic
1185687392 X:1940574-1940596 CTTTCTAAGAAGGAGGCAGAGGG - Intergenic
1186341966 X:8655059-8655081 CTGGGTGAGGAGGAGGAGAATGG + Intronic
1186473976 X:9842861-9842883 CTGTCTTAGGGAGAGAAGGAGGG + Intronic
1186524401 X:10235223-10235245 CTTTCTAAGTGGGAAGAGGAAGG + Exonic
1187151419 X:16685210-16685232 CTGTCTATGGAGGAGGGAGAAGG - Intronic
1187380571 X:18798274-18798296 CTTTCTGAGGCAGAGGAGGAAGG - Intronic
1188065645 X:25656329-25656351 CTGGGTTAGGAGGTGGAGGAGGG - Intergenic
1188156399 X:26748296-26748318 CTGGAGAAGGAGGAAGAGGAGGG + Intergenic
1188524539 X:31075010-31075032 CTCTCTGAGGAGAAGGAGGCAGG + Intergenic
1189207503 X:39254437-39254459 CTAGAAAAGGAGGAGGAGGATGG + Intergenic
1189824092 X:44899184-44899206 CTGTGGAGGGAGGGGGAGGAAGG + Intronic
1189984671 X:46543662-46543684 CTGCCAAAGAAGGAGGAGCATGG - Intronic
1190101014 X:47523350-47523372 CTATCAAAAGAAGAGGAGGATGG + Intergenic
1192180272 X:68911971-68911993 AGGTCTGGGGAGGAGGAGGATGG - Intergenic
1194958467 X:100208381-100208403 CTTTCAAGGGAGGAGGAGGGAGG - Intergenic
1195551849 X:106180442-106180464 CTCTCAAAGGAGTAGGAAGATGG - Intronic
1195570407 X:106393578-106393600 TTGTCTCAGGTGGAAGAGGAAGG - Intergenic
1195704126 X:107726192-107726214 CTCTCCAAGGGGGAGTAGGAGGG + Intronic
1196862293 X:120039720-120039742 TTCTCTGAGGAGGAGGAGCAAGG - Intergenic
1196880809 X:120196624-120196646 TTCTCTGAGGAGGAGGAGCAAGG + Intergenic
1199190424 X:144963665-144963687 CTGTCAGAGGAGGAAGAAGAAGG - Intergenic
1199323154 X:146464588-146464610 CTGTTTAAGGAGGATAAAGATGG + Intergenic
1199777808 X:151030966-151030988 CTCTCTGAGGAGGAGGAAGTGGG + Intergenic
1200887219 Y:8281671-8281693 CTGGCCAAGAAGGAGGAGGATGG - Intergenic
1201283259 Y:12358971-12358993 CTCTCTCAGTGGGAGGAGGAGGG + Intergenic
1201286143 Y:12380356-12380378 CTGTCTATGTAGGAGGAAGCAGG - Intergenic