ID: 983651451

View in Genome Browser
Species Human (GRCh38)
Location 4:170040495-170040517
Sequence CAGCCCCTCCTGCAGCCTTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983651451_983651460 22 Left 983651451 4:170040495-170040517 CCGGAAGGCTGCAGGAGGGGCTG No data
Right 983651460 4:170040540-170040562 GGACTTGTGGTGCCTTTTCTGGG No data
983651451_983651457 9 Left 983651451 4:170040495-170040517 CCGGAAGGCTGCAGGAGGGGCTG No data
Right 983651457 4:170040527-170040549 CCCACTGGAGTGTGGACTTGTGG No data
983651451_983651454 1 Left 983651451 4:170040495-170040517 CCGGAAGGCTGCAGGAGGGGCTG No data
Right 983651454 4:170040519-170040541 CAGATCCACCCACTGGAGTGTGG No data
983651451_983651459 21 Left 983651451 4:170040495-170040517 CCGGAAGGCTGCAGGAGGGGCTG No data
Right 983651459 4:170040539-170040561 TGGACTTGTGGTGCCTTTTCTGG No data
983651451_983651452 -6 Left 983651451 4:170040495-170040517 CCGGAAGGCTGCAGGAGGGGCTG No data
Right 983651452 4:170040512-170040534 GGGCTGCCAGATCCACCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983651451 Original CRISPR CAGCCCCTCCTGCAGCCTTC CGG (reversed) Intergenic