ID: 983651455

View in Genome Browser
Species Human (GRCh38)
Location 4:170040524-170040546
Sequence CAAGTCCACACTCCAGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983651455_983651460 -7 Left 983651455 4:170040524-170040546 CCACCCACTGGAGTGTGGACTTG No data
Right 983651460 4:170040540-170040562 GGACTTGTGGTGCCTTTTCTGGG No data
983651455_983651463 13 Left 983651455 4:170040524-170040546 CCACCCACTGGAGTGTGGACTTG No data
Right 983651463 4:170040560-170040582 GGGCCTCCCCATGGACCAATTGG No data
983651455_983651461 4 Left 983651455 4:170040524-170040546 CCACCCACTGGAGTGTGGACTTG No data
Right 983651461 4:170040551-170040573 GCCTTTTCTGGGCCTCCCCATGG No data
983651455_983651459 -8 Left 983651455 4:170040524-170040546 CCACCCACTGGAGTGTGGACTTG No data
Right 983651459 4:170040539-170040561 TGGACTTGTGGTGCCTTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983651455 Original CRISPR CAAGTCCACACTCCAGTGGG TGG (reversed) Intergenic