ID: 983651456

View in Genome Browser
Species Human (GRCh38)
Location 4:170040527-170040549
Sequence CCACAAGTCCACACTCCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983651456_983651460 -10 Left 983651456 4:170040527-170040549 CCCACTGGAGTGTGGACTTGTGG No data
Right 983651460 4:170040540-170040562 GGACTTGTGGTGCCTTTTCTGGG No data
983651456_983651461 1 Left 983651456 4:170040527-170040549 CCCACTGGAGTGTGGACTTGTGG No data
Right 983651461 4:170040551-170040573 GCCTTTTCTGGGCCTCCCCATGG No data
983651456_983651463 10 Left 983651456 4:170040527-170040549 CCCACTGGAGTGTGGACTTGTGG No data
Right 983651463 4:170040560-170040582 GGGCCTCCCCATGGACCAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983651456 Original CRISPR CCACAAGTCCACACTCCAGT GGG (reversed) Intergenic