ID: 983651458

View in Genome Browser
Species Human (GRCh38)
Location 4:170040528-170040550
Sequence ACCACAAGTCCACACTCCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983651458_983651461 0 Left 983651458 4:170040528-170040550 CCACTGGAGTGTGGACTTGTGGT No data
Right 983651461 4:170040551-170040573 GCCTTTTCTGGGCCTCCCCATGG No data
983651458_983651463 9 Left 983651458 4:170040528-170040550 CCACTGGAGTGTGGACTTGTGGT No data
Right 983651463 4:170040560-170040582 GGGCCTCCCCATGGACCAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983651458 Original CRISPR ACCACAAGTCCACACTCCAG TGG (reversed) Intergenic