ID: 983651459

View in Genome Browser
Species Human (GRCh38)
Location 4:170040539-170040561
Sequence TGGACTTGTGGTGCCTTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983651451_983651459 21 Left 983651451 4:170040495-170040517 CCGGAAGGCTGCAGGAGGGGCTG No data
Right 983651459 4:170040539-170040561 TGGACTTGTGGTGCCTTTTCTGG No data
983651455_983651459 -8 Left 983651455 4:170040524-170040546 CCACCCACTGGAGTGTGGACTTG No data
Right 983651459 4:170040539-170040561 TGGACTTGTGGTGCCTTTTCTGG No data
983651453_983651459 -2 Left 983651453 4:170040518-170040540 CCAGATCCACCCACTGGAGTGTG No data
Right 983651459 4:170040539-170040561 TGGACTTGTGGTGCCTTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983651459 Original CRISPR TGGACTTGTGGTGCCTTTTC TGG Intergenic
No off target data available for this crispr