ID: 983651460

View in Genome Browser
Species Human (GRCh38)
Location 4:170040540-170040562
Sequence GGACTTGTGGTGCCTTTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983651453_983651460 -1 Left 983651453 4:170040518-170040540 CCAGATCCACCCACTGGAGTGTG No data
Right 983651460 4:170040540-170040562 GGACTTGTGGTGCCTTTTCTGGG No data
983651451_983651460 22 Left 983651451 4:170040495-170040517 CCGGAAGGCTGCAGGAGGGGCTG No data
Right 983651460 4:170040540-170040562 GGACTTGTGGTGCCTTTTCTGGG No data
983651455_983651460 -7 Left 983651455 4:170040524-170040546 CCACCCACTGGAGTGTGGACTTG No data
Right 983651460 4:170040540-170040562 GGACTTGTGGTGCCTTTTCTGGG No data
983651456_983651460 -10 Left 983651456 4:170040527-170040549 CCCACTGGAGTGTGGACTTGTGG No data
Right 983651460 4:170040540-170040562 GGACTTGTGGTGCCTTTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983651460 Original CRISPR GGACTTGTGGTGCCTTTTCT GGG Intergenic