ID: 983651461

View in Genome Browser
Species Human (GRCh38)
Location 4:170040551-170040573
Sequence GCCTTTTCTGGGCCTCCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983651458_983651461 0 Left 983651458 4:170040528-170040550 CCACTGGAGTGTGGACTTGTGGT No data
Right 983651461 4:170040551-170040573 GCCTTTTCTGGGCCTCCCCATGG No data
983651456_983651461 1 Left 983651456 4:170040527-170040549 CCCACTGGAGTGTGGACTTGTGG No data
Right 983651461 4:170040551-170040573 GCCTTTTCTGGGCCTCCCCATGG No data
983651455_983651461 4 Left 983651455 4:170040524-170040546 CCACCCACTGGAGTGTGGACTTG No data
Right 983651461 4:170040551-170040573 GCCTTTTCTGGGCCTCCCCATGG No data
983651453_983651461 10 Left 983651453 4:170040518-170040540 CCAGATCCACCCACTGGAGTGTG No data
Right 983651461 4:170040551-170040573 GCCTTTTCTGGGCCTCCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983651461 Original CRISPR GCCTTTTCTGGGCCTCCCCA TGG Intergenic