ID: 983651597

View in Genome Browser
Species Human (GRCh38)
Location 4:170041580-170041602
Sequence GTCCATATGAGGCTACTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983651597_983651602 12 Left 983651597 4:170041580-170041602 CCAGGGAGTAGCCTCATATGGAC No data
Right 983651602 4:170041615-170041637 TTTTAACTGGCCTCCACCACCGG No data
983651597_983651600 -1 Left 983651597 4:170041580-170041602 CCAGGGAGTAGCCTCATATGGAC No data
Right 983651600 4:170041602-170041624 CCCTTTTGCTACTTTTTAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983651597 Original CRISPR GTCCATATGAGGCTACTCCC TGG (reversed) Intergenic
No off target data available for this crispr