ID: 983651600

View in Genome Browser
Species Human (GRCh38)
Location 4:170041602-170041624
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983651594_983651600 12 Left 983651594 4:170041567-170041589 CCTCATGCAAAACCCAGGGAGTA No data
Right 983651600 4:170041602-170041624 CCCTTTTGCTACTTTTTAACTGG No data
983651596_983651600 0 Left 983651596 4:170041579-170041601 CCCAGGGAGTAGCCTCATATGGA No data
Right 983651600 4:170041602-170041624 CCCTTTTGCTACTTTTTAACTGG No data
983651590_983651600 23 Left 983651590 4:170041556-170041578 CCAGCCTTCTACCTCATGCAAAA No data
Right 983651600 4:170041602-170041624 CCCTTTTGCTACTTTTTAACTGG No data
983651597_983651600 -1 Left 983651597 4:170041580-170041602 CCAGGGAGTAGCCTCATATGGAC No data
Right 983651600 4:170041602-170041624 CCCTTTTGCTACTTTTTAACTGG No data
983651591_983651600 19 Left 983651591 4:170041560-170041582 CCTTCTACCTCATGCAAAACCCA No data
Right 983651600 4:170041602-170041624 CCCTTTTGCTACTTTTTAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type