ID: 983651602

View in Genome Browser
Species Human (GRCh38)
Location 4:170041615-170041637
Sequence TTTTAACTGGCCTCCACCAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983651594_983651602 25 Left 983651594 4:170041567-170041589 CCTCATGCAAAACCCAGGGAGTA No data
Right 983651602 4:170041615-170041637 TTTTAACTGGCCTCCACCACCGG No data
983651598_983651602 1 Left 983651598 4:170041591-170041613 CCTCATATGGACCCTTTTGCTAC No data
Right 983651602 4:170041615-170041637 TTTTAACTGGCCTCCACCACCGG No data
983651599_983651602 -10 Left 983651599 4:170041602-170041624 CCCTTTTGCTACTTTTTAACTGG No data
Right 983651602 4:170041615-170041637 TTTTAACTGGCCTCCACCACCGG No data
983651597_983651602 12 Left 983651597 4:170041580-170041602 CCAGGGAGTAGCCTCATATGGAC No data
Right 983651602 4:170041615-170041637 TTTTAACTGGCCTCCACCACCGG No data
983651596_983651602 13 Left 983651596 4:170041579-170041601 CCCAGGGAGTAGCCTCATATGGA No data
Right 983651602 4:170041615-170041637 TTTTAACTGGCCTCCACCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983651602 Original CRISPR TTTTAACTGGCCTCCACCAC CGG Intergenic
No off target data available for this crispr