ID: 983651812

View in Genome Browser
Species Human (GRCh38)
Location 4:170043237-170043259
Sequence TGCAAGTGCAGAGTTGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983651812_983651815 6 Left 983651812 4:170043237-170043259 CCTTGCCCAACTCTGCACTTGCA No data
Right 983651815 4:170043266-170043288 ACCACCAACCTCTAGTAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983651812 Original CRISPR TGCAAGTGCAGAGTTGGGCA AGG (reversed) Intergenic
No off target data available for this crispr