ID: 983654549

View in Genome Browser
Species Human (GRCh38)
Location 4:170069522-170069544
Sequence TAATCCTGGATTTCAACCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 158}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983654549_983654553 -6 Left 983654549 4:170069522-170069544 CCAGAGGTTGAAATCCAGGATTA 0: 1
1: 0
2: 2
3: 21
4: 158
Right 983654553 4:170069539-170069561 GGATTAACAGACTTACAGGAGGG 0: 1
1: 0
2: 0
3: 8
4: 113
983654549_983654552 -7 Left 983654549 4:170069522-170069544 CCAGAGGTTGAAATCCAGGATTA 0: 1
1: 0
2: 2
3: 21
4: 158
Right 983654552 4:170069538-170069560 AGGATTAACAGACTTACAGGAGG 0: 1
1: 0
2: 0
3: 7
4: 123
983654549_983654550 -10 Left 983654549 4:170069522-170069544 CCAGAGGTTGAAATCCAGGATTA 0: 1
1: 0
2: 2
3: 21
4: 158
Right 983654550 4:170069535-170069557 TCCAGGATTAACAGACTTACAGG 0: 1
1: 0
2: 0
3: 6
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983654549 Original CRISPR TAATCCTGGATTTCAACCTC TGG (reversed) Intronic
900880239 1:5376416-5376438 TTATCCCGGATTTCATCTTCAGG + Intergenic
903914226 1:26751495-26751517 TAATAATGGATTTGAACCTCAGG + Intronic
904608824 1:31714242-31714264 TAAACCTGGGTGTCATCCTCGGG + Intergenic
907096431 1:51785391-51785413 TAATGCAGGCTTTCATCCTCAGG - Intronic
907844323 1:58190073-58190095 TAATACTGGATTAGAACATCTGG + Intronic
908533446 1:65055512-65055534 TAATCCAGCATTTCCACTTCTGG - Intergenic
909562601 1:77023172-77023194 TGATCTTGGACTTCAGCCTCTGG + Intronic
912031723 1:105254620-105254642 TAATCCTGAATTTGAAGCTCTGG + Intergenic
915159042 1:153903418-153903440 TAATCCTGAATCTCAAACTATGG - Intronic
918132448 1:181641641-181641663 CAATCATGGTCTTCAACCTCGGG + Intronic
919149405 1:193676417-193676439 TAATCCTGGATTTCAAACTAAGG - Intergenic
919207283 1:194434431-194434453 TATTGCTGGACTTTAACCTCAGG - Intergenic
919410048 1:197231635-197231657 TAATCCCTTATTTCACCCTCTGG - Intergenic
920839358 1:209540980-209541002 TTATCCTGGCTTTGAACCTCCGG + Intergenic
921263993 1:213407125-213407147 CAGTCCTGGAATTCAACCACTGG - Intergenic
921664848 1:217856411-217856433 TAAACCTGGATTTCAAACTCAGG + Intronic
922356996 1:224785931-224785953 TAAGCCTGGATTTCCAACTCAGG + Intergenic
923181200 1:231521647-231521669 TAAACCTGGGTTTCTTCCTCAGG + Intergenic
1063319894 10:5043018-5043040 TAATGCTGTACTTCAACCTCTGG - Intronic
1064231868 10:13536410-13536432 TAAACCTGGGTTTCAAACCCAGG - Intergenic
1064352846 10:14592525-14592547 TAATCCTGCATTTCTACCCAGGG + Intronic
1065233960 10:23627898-23627920 TAAACCTGAGTTTCATCCTCGGG + Intergenic
1065288887 10:24210502-24210524 TACTTCAGGAATTCAACCTCTGG + Intronic
1067705388 10:48603225-48603247 AAATCCTGGATTTCAAAGACAGG + Intronic
1069708934 10:70477120-70477142 TTATCCTGGAATGCATCCTCAGG + Intergenic
1069981076 10:72252971-72252993 TAATCCAGGATTCCAGCATCTGG - Intergenic
1070062658 10:72999998-73000020 TGATCCAGCATTTCCACCTCTGG - Intergenic
1073842498 10:107514053-107514075 CAAGCCTGAATTTCATCCTCTGG + Intergenic
1075124452 10:119688504-119688526 TATTCCTGGCTTTTAACCACTGG + Intergenic
1075768264 10:124912164-124912186 CAATCCTGGAGATCAACATCAGG - Intergenic
1076750307 10:132538909-132538931 GAACCCTGAATTTCAACCTCAGG + Intronic
1078629851 11:12992468-12992490 TCTTTCAGGATTTCAACCTCGGG + Intergenic
1079971333 11:27039562-27039584 TAATCCTGCAATCCTACCTCTGG + Intergenic
1081213432 11:40363785-40363807 CAATTCTGGCTTTGAACCTCTGG + Intronic
1081513187 11:43797077-43797099 TATTCATGGATTTCTACCTAGGG + Intronic
1082275087 11:50212700-50212722 TAATCCTGAATGTGAACCACAGG + Intergenic
1086770684 11:90761586-90761608 TGATCCTGGATATCAACTTTCGG + Intergenic
1087815677 11:102655823-102655845 TAATCCTGGATTACAAACATGGG - Intergenic
1088456151 11:110034861-110034883 TACTCATGGATTTTATCCTCAGG - Intergenic
1091959379 12:4679240-4679262 TAATCCTGGATTTTACTCCCAGG - Intronic
1096559575 12:52425797-52425819 TAACCCTTAATTTCAGCCTCCGG + Intronic
1097637704 12:62143012-62143034 GAATCCTGGATTTGAACTTTGGG - Intronic
1099775321 12:87119971-87119993 TAATTCTAGATTTTAATCTCTGG - Intergenic
1101051669 12:100870017-100870039 TAATCCTGGAATCCCACTTCAGG + Intronic
1107729175 13:43331154-43331176 GACTCCTGAATTTCAAGCTCTGG + Intronic
1112273364 13:97992187-97992209 TAATCCCGGTTTTCTTCCTCTGG + Intronic
1112942198 13:104877191-104877213 TAATACTACAGTTCAACCTCTGG - Intergenic
1113780605 13:112974581-112974603 TAATTCTGGAGTGCACCCTCTGG - Intronic
1113983187 13:114293639-114293661 TAAACCTAGATTTGAACCTAAGG + Intronic
1115410153 14:33065032-33065054 AAATCCTGAATTTCAACACCAGG - Intronic
1116800530 14:49439025-49439047 TAAGCCAGGATTCCAACCTAGGG - Intergenic
1118085993 14:62417980-62418002 TAACCATGAATTTCAACTTCAGG + Intergenic
1126535786 15:49762459-49762481 TAATCCAGCAATTCCACCTCTGG - Intergenic
1127347220 15:58112874-58112896 TGATCCTGGGGTTGAACCTCAGG - Intronic
1127802166 15:62486367-62486389 TAATCCTGGATTGAATCCTAGGG - Intronic
1132315955 15:100890665-100890687 CAGTCCTGGATTACCACCTCTGG - Intronic
1132370264 15:101292356-101292378 TAATTCTGGATTCCCAGCTCAGG + Intronic
1132947526 16:2540104-2540126 TGATCCTGGATTTTCACCTGAGG + Intronic
1137978711 16:53052609-53052631 AAGTCCTAGATTACAACCTCTGG - Intergenic
1139021333 16:62753481-62753503 TAACCATGGGTTTTAACCTCTGG + Intergenic
1139664049 16:68443861-68443883 CCATCCTGGATCTCAAACTCTGG - Intronic
1140972891 16:80030316-80030338 TAAACCAGGATTTAAACCTCAGG - Intergenic
1143130804 17:4675824-4675846 AAATCCTGGATTTCATCTGCCGG - Exonic
1144469631 17:15526219-15526241 GAAACCTGGAACTCAACCTCAGG - Intronic
1144926721 17:18817434-18817456 GAAACCTGGAACTCAACCTCAGG + Intergenic
1148083123 17:44978350-44978372 TAGTCCTGGCTTCCAGCCTCTGG + Intergenic
1148538719 17:48462712-48462734 TAGTCCTGAATTTCTACCTAAGG - Intergenic
1151371584 17:73649922-73649944 TACTCCTGGCTTTCAAGCCCTGG + Intergenic
1151920471 17:77150968-77150990 TCATCCTGGATTTCATCCTTGGG + Intronic
1153397979 18:4646770-4646792 TAATTCAGTAATTCAACCTCTGG + Intergenic
1156100957 18:33594199-33594221 TAATGCTGAATGGCAACCTCTGG + Intronic
1156779574 18:40835471-40835493 TGATCCTTTATTTCAACCTGTGG + Intergenic
1159194757 18:65098640-65098662 TATTCCAGGAGTTCAAACTCAGG + Intergenic
1159198210 18:65146066-65146088 TAAACCTCGAGTTTAACCTCAGG - Intergenic
1160100377 18:75915310-75915332 AAATCCTGGATTTGAACCTTAGG - Intergenic
1166906224 19:46110323-46110345 TGCTCCTGTATTTCACCCTCAGG + Intergenic
926427570 2:12753324-12753346 AAATGCTGGAGTTCAAACTCAGG - Intergenic
927399583 2:22695398-22695420 TAATGCTGGATTGAAAACTCTGG - Intergenic
929888433 2:45899162-45899184 TAAGCCTGGATTTGACCTTCAGG + Intronic
930135817 2:47904449-47904471 TAAAGCAGGATTTCAACCTCGGG + Intronic
931400738 2:61929053-61929075 TAACTCTGGCTTTGAACCTCTGG - Intronic
936498865 2:113050083-113050105 TGATCCAGGAGTTCCACCTCTGG + Intronic
937069578 2:119053057-119053079 TAAAACTGGATTTGAACCCCAGG + Intergenic
937102963 2:119285876-119285898 TAAGCCTGATCTTCAACCTCAGG + Intergenic
938079387 2:128361544-128361566 TGATCTTGGACTTCAGCCTCCGG + Intergenic
939663016 2:144913897-144913919 TAAACCTGGAATTCATCCTTAGG + Intergenic
941340988 2:164302957-164302979 TAATCCTTGAGTTAAACCTGCGG - Intergenic
941618701 2:167753150-167753172 TAATCCTAAATTTCAAACTCAGG - Intergenic
942997963 2:182287679-182287701 TAAACCTGACTTTCAACCACAGG - Intronic
943796816 2:192006716-192006738 AAATCCTGGATTTCAAATTCTGG + Intronic
945911217 2:215651598-215651620 TTATCCCTGATTTTAACCTCTGG + Intergenic
946000645 2:216479113-216479135 TACTCCTGGTTTTCACCTTCTGG - Intronic
946256456 2:218445562-218445584 TATAGATGGATTTCAACCTCAGG - Intronic
948049810 2:234971505-234971527 TAATCCAGCAATTCCACCTCTGG - Intronic
949032560 2:241804012-241804034 ACATCCTGGGTTACAACCTCCGG + Exonic
1168871167 20:1129798-1129820 TAATCCTGCATGTCCACTTCCGG + Intronic
1174196511 20:48776255-48776277 TCATCCTGGACCACAACCTCAGG + Intronic
1174219147 20:48938729-48938751 AAAATCTGGATTTCGACCTCTGG + Intronic
1174596948 20:51691719-51691741 TAATCCAGCAATTCCACCTCCGG + Intronic
1174668037 20:52278681-52278703 TATTTCTGGATTTCATCCGCTGG + Intergenic
1175371411 20:58495556-58495578 TCAGCCTGGGCTTCAACCTCTGG - Intronic
1177229802 21:18305149-18305171 AAATCCTGGAATCCTACCTCTGG - Intronic
1182106023 22:27690150-27690172 TAAGCCTGGGATTCAAACTCAGG + Intergenic
1184003933 22:41695223-41695245 TGTTCCTGGATCTCAGCCTCGGG - Exonic
1184173341 22:42772324-42772346 TCATCTTGGACTTCAGCCTCTGG + Intergenic
950626411 3:14250557-14250579 TGATCATGGACTTCAGCCTCTGG + Intergenic
952768108 3:36972866-36972888 TAATCCAGCATTTCAACTTCTGG - Intergenic
961159037 3:124706365-124706387 AAACCCTGGCTGTCAACCTCTGG - Intronic
961308142 3:125974039-125974061 TAATCATGGATTTCATTCTTTGG - Intronic
961797705 3:129421618-129421640 TAATCCTGCATCCCAACCTCAGG - Exonic
962590214 3:136882039-136882061 TAATCCAGCAATTCAACTTCTGG - Intronic
964276446 3:155013286-155013308 GAATCCTGGCTTTCAAGCTTAGG - Intergenic
965445957 3:168773712-168773734 TAATCCTGTATATCAATTTCAGG + Intergenic
965674649 3:171181936-171181958 TAATCCTGGATTTATTCCACAGG + Intronic
965847949 3:172986703-172986725 GAAGCCTGGATTTCATCCTGTGG + Intronic
966222666 3:177566115-177566137 TAAACCTGGATTTCTGCCTCAGG + Intergenic
966264589 3:178023835-178023857 TACTCTTGGGTTTCAGCCTCTGG + Intergenic
970548342 4:17153275-17153297 CAATCCTGGCTTTGAATCTCTGG + Intergenic
970912930 4:21298978-21299000 TAAAACTGGAATTCAAACTCAGG - Intronic
972427712 4:38950025-38950047 TAATCCTCCATATCAACCTTAGG + Intergenic
973316676 4:48767823-48767845 TAATCCTGGATTGCAGCTACGGG + Intronic
975872635 4:78797463-78797485 TAAACCTGGAATTGAATCTCTGG - Intronic
976087884 4:81424757-81424779 TAATACAGGATTTAAAGCTCTGG + Intergenic
976895345 4:90103258-90103280 TAATCCTTGAGTTCAATCTGTGG - Intergenic
977129666 4:93219638-93219660 TAATCCTGGGTTTCAGTCTTTGG - Intronic
978328070 4:107580890-107580912 TTTTCCTGCATTTCAACCTTGGG - Intergenic
979913740 4:126404514-126404536 AATGCCTGGATTTCAGCCTCGGG - Intergenic
983654549 4:170069522-170069544 TAATCCTGGATTTCAACCTCTGG - Intronic
984325714 4:178248124-178248146 TATTCCTGGTTCTCAAACTCAGG + Intergenic
984777318 4:183493060-183493082 TTGTCCTGGACTCCAACCTCTGG + Intergenic
991578093 5:68125754-68125776 AAACCCTGGATGACAACCTCAGG + Intergenic
992723847 5:79586739-79586761 TAAAGCTGGAGTTCAAGCTCAGG + Intergenic
993041752 5:82822594-82822616 AAATCCTGGCTTTCAAACTCAGG + Intergenic
997198633 5:131996145-131996167 TAAAACTGGATTTCCAGCTCAGG - Intronic
999088477 5:148913985-148914007 TAGACCTGGATTCAAACCTCAGG + Intergenic
999190903 5:149746614-149746636 TAATCCAGCAATTCCACCTCTGG - Intronic
1003925228 6:10871303-10871325 TCATTCTGGATTTCAACATTTGG + Intronic
1004614536 6:17278081-17278103 TAATCATGGAAATCAACTTCAGG - Intergenic
1010527499 6:76921924-76921946 TAATCTAGGAATTCAACTTCTGG + Intergenic
1010627619 6:78157804-78157826 TAATCCTGCATTCCTACCACAGG - Intergenic
1014197376 6:118575843-118575865 TAACCCTGGATTTCTTCCCCCGG - Intronic
1014321720 6:119938082-119938104 CCATTCTGGATATCAACCTCGGG - Intergenic
1017072050 6:150584216-150584238 CAATCCTTGATGTCATCCTCTGG + Intergenic
1018156513 6:160991024-160991046 TAACTCTGGATTTCACCCTATGG + Intergenic
1021301086 7:18973967-18973989 TGATCCTGGACTTCAACCTGAGG - Intronic
1022815290 7:33907373-33907395 TAATTCTGGATTTCTTTCTCGGG + Intronic
1030894133 7:115036375-115036397 TATTCCTGGGGTTCCACCTCTGG + Intergenic
1033256630 7:139807043-139807065 TCATCCTGGATTCCTGCCTCTGG + Intronic
1036571318 8:9982145-9982167 TTAGCCTTTATTTCAACCTCTGG + Intergenic
1037489085 8:19379532-19379554 TAATCCTGAAATTCCACCTCTGG - Intronic
1037736198 8:21568660-21568682 TAATCCAGGAATTCCACTTCTGG + Intergenic
1040812377 8:51469536-51469558 TAATCCTCCATTTCTACCTCTGG + Intronic
1041844361 8:62310919-62310941 TAATCCTGGATTGAAACCTGAGG - Intronic
1044767759 8:95594822-95594844 CAATCCTGTATTTAAACATCTGG - Intergenic
1045072457 8:98523056-98523078 TAATCCAGCAATTCTACCTCTGG - Intronic
1047171782 8:122500693-122500715 TACACCAGGATTTCAACCACTGG - Intergenic
1048443087 8:134474399-134474421 GAATCCTGGATTTCATCCAAGGG + Intergenic
1049491660 8:142906863-142906885 TAATGCTGGAGCTCAGCCTCAGG + Intronic
1049915893 9:318373-318395 TAAGGCTGGGTTTCAACCCCTGG + Intronic
1051118612 9:13727226-13727248 AAAACCTGGTTTTCTACCTCTGG - Intergenic
1051768773 9:20553096-20553118 TAATTCTGGATTCTGACCTCTGG - Intronic
1052335670 9:27317428-27317450 TAAACCTGGGTTTTAATCTCTGG - Intergenic
1053425359 9:38006589-38006611 TATTCCTGTATTTCTACCTTGGG + Intronic
1053468784 9:38330382-38330404 TGACCCTGGATTACAACCCCTGG - Intergenic
1054782146 9:69175081-69175103 TAATCAGGGATTTCTACCACAGG + Intronic
1055428243 9:76217761-76217783 TAGTCCTGGATTCCACACTCTGG + Intronic
1055704906 9:78987713-78987735 TAATCCTGGGTTCCAAGCTAAGG + Intergenic
1055740479 9:79382917-79382939 CATTCCTGCAATTCAACCTCAGG - Intergenic
1057398374 9:94700678-94700700 CAATTCTGGCTTTGAACCTCTGG - Intergenic
1059006402 9:110407523-110407545 TAATCCAGGATATGAACTTCTGG - Exonic
1059376008 9:113882251-113882273 TGAGGCTGGATTTCAAACTCTGG - Intronic
1060398362 9:123332300-123332322 TGAGCCTGGATTTCCTCCTCTGG + Intergenic
1060456342 9:123802337-123802359 AAACCCTAGATTTTAACCTCTGG + Intronic
1060562024 9:124553613-124553635 ACATCCTCGATTTCAACTTCTGG + Intronic
1060874324 9:127069517-127069539 TAATCCAGGTTTCCAACCTTGGG - Intronic
1060953120 9:127617672-127617694 TAAGGCTGGAATTCAAACTCGGG + Intronic
1061359879 9:130134357-130134379 TAATCCTTGATTTCAACGAATGG + Intronic
1061756560 9:132816766-132816788 TCATCCTGGATTTCTACCTATGG + Intronic
1062677272 9:137754167-137754189 TAATGCTGGATTCCGAACTCTGG - Exonic
1188246606 X:27842096-27842118 TAATACTGGATTATAACCTGGGG - Intergenic
1192538872 X:71951380-71951402 TAATCCAGCAATTCTACCTCTGG - Intergenic
1200365233 X:155656032-155656054 TTTTCCTGGGTTTCAACCTTGGG + Intronic