ID: 983657220

View in Genome Browser
Species Human (GRCh38)
Location 4:170095296-170095318
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983657216_983657220 -4 Left 983657216 4:170095277-170095299 CCAGAAAGTGGGTCCCGTAGGGA No data
Right 983657220 4:170095296-170095318 GGGATGAGGAGTCAATCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr