ID: 983657527

View in Genome Browser
Species Human (GRCh38)
Location 4:170098327-170098349
Sequence TTTTAGCCACAGCTGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983657523_983657527 -3 Left 983657523 4:170098307-170098329 CCGAGCTGTACTTTGGCTCCTTT No data
Right 983657527 4:170098327-170098349 TTTTAGCCACAGCTGGAGCTGGG No data
983657519_983657527 13 Left 983657519 4:170098291-170098313 CCTCTGAAGCCATGGCCCGAGCT 0: 34
1: 351
2: 964
3: 1453
4: 1505
Right 983657527 4:170098327-170098349 TTTTAGCCACAGCTGGAGCTGGG No data
983657518_983657527 14 Left 983657518 4:170098290-170098312 CCCTCTGAAGCCATGGCCCGAGC 0: 34
1: 362
2: 929
3: 1368
4: 1452
Right 983657527 4:170098327-170098349 TTTTAGCCACAGCTGGAGCTGGG No data
983657520_983657527 4 Left 983657520 4:170098300-170098322 CCATGGCCCGAGCTGTACTTTGG No data
Right 983657527 4:170098327-170098349 TTTTAGCCACAGCTGGAGCTGGG No data
983657522_983657527 -2 Left 983657522 4:170098306-170098328 CCCGAGCTGTACTTTGGCTCCTT No data
Right 983657527 4:170098327-170098349 TTTTAGCCACAGCTGGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983657527 Original CRISPR TTTTAGCCACAGCTGGAGCT GGG Intergenic
No off target data available for this crispr