ID: 983657821

View in Genome Browser
Species Human (GRCh38)
Location 4:170100796-170100818
Sequence CAGTGATTGTCCCCTCCTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983657817_983657821 -9 Left 983657817 4:170100782-170100804 CCAAGTGAACCCTCCAGTGATTG No data
Right 983657821 4:170100796-170100818 CAGTGATTGTCCCCTCCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983657821 Original CRISPR CAGTGATTGTCCCCTCCTAC AGG Intergenic
No off target data available for this crispr