ID: 983659288

View in Genome Browser
Species Human (GRCh38)
Location 4:170116889-170116911
Sequence CAGAACAAAGAGTAGGAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983659288_983659291 4 Left 983659288 4:170116889-170116911 CCGTCCTCCTACTCTTTGTTCTG No data
Right 983659291 4:170116916-170116938 AAAGATCCACCTATGATCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983659288 Original CRISPR CAGAACAAAGAGTAGGAGGA CGG (reversed) Intergenic
No off target data available for this crispr