ID: 983663375

View in Genome Browser
Species Human (GRCh38)
Location 4:170154808-170154830
Sequence TGTGGGCTAGCTCACAGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983663372_983663375 -10 Left 983663372 4:170154795-170154817 CCAAGCCTCATGGTGTGGGCTAG No data
Right 983663375 4:170154808-170154830 TGTGGGCTAGCTCACAGTGGTGG No data
983663367_983663375 29 Left 983663367 4:170154756-170154778 CCATTGTGTGGAGCATTGACTTG No data
Right 983663375 4:170154808-170154830 TGTGGGCTAGCTCACAGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983663375 Original CRISPR TGTGGGCTAGCTCACAGTGG TGG Intergenic
No off target data available for this crispr