ID: 983667022

View in Genome Browser
Species Human (GRCh38)
Location 4:170193791-170193813
Sequence CTTAAAAACCCTATTGAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983667022_983667024 -4 Left 983667022 4:170193791-170193813 CCAAGTTCAATAGGGTTTTTAAG No data
Right 983667024 4:170193810-170193832 TAAGTTTTGCTCCAGGCCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983667022 Original CRISPR CTTAAAAACCCTATTGAACT TGG (reversed) Intergenic
No off target data available for this crispr