ID: 983675634

View in Genome Browser
Species Human (GRCh38)
Location 4:170289165-170289187
Sequence GTGTGGGATATATCACTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983675634_983675645 23 Left 983675634 4:170289165-170289187 CCTTTCAGTGATATATCCCACAC No data
Right 983675645 4:170289211-170289233 CATCCTGCAGGCAGCTCTCTTGG No data
983675634_983675642 11 Left 983675634 4:170289165-170289187 CCTTTCAGTGATATATCCCACAC No data
Right 983675642 4:170289199-170289221 GCTGTGGTCCCTCATCCTGCAGG No data
983675634_983675638 -5 Left 983675634 4:170289165-170289187 CCTTTCAGTGATATATCCCACAC No data
Right 983675638 4:170289183-170289205 CACACGGCCCCTTTCTGCTGTGG No data
983675634_983675646 24 Left 983675634 4:170289165-170289187 CCTTTCAGTGATATATCCCACAC No data
Right 983675646 4:170289212-170289234 ATCCTGCAGGCAGCTCTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983675634 Original CRISPR GTGTGGGATATATCACTGAA AGG (reversed) Intergenic
No off target data available for this crispr