ID: 983677640

View in Genome Browser
Species Human (GRCh38)
Location 4:170314707-170314729
Sequence AAACTCAGCTTCACAAAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983677640_983677641 0 Left 983677640 4:170314707-170314729 CCTATCTTTGTGAAGCTGAGTTT No data
Right 983677641 4:170314730-170314752 TCCGAACTTGCTGTATAATTTGG No data
983677640_983677643 7 Left 983677640 4:170314707-170314729 CCTATCTTTGTGAAGCTGAGTTT No data
Right 983677643 4:170314737-170314759 TTGCTGTATAATTTGGAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983677640 Original CRISPR AAACTCAGCTTCACAAAGAT AGG (reversed) Intergenic