ID: 983677640 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:170314707-170314729 |
| Sequence | AAACTCAGCTTCACAAAGAT AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 983677640_983677641 | 0 | Left | 983677640 | 4:170314707-170314729 | CCTATCTTTGTGAAGCTGAGTTT | No data | ||
| Right | 983677641 | 4:170314730-170314752 | TCCGAACTTGCTGTATAATTTGG | No data | ||||
| 983677640_983677643 | 7 | Left | 983677640 | 4:170314707-170314729 | CCTATCTTTGTGAAGCTGAGTTT | No data | ||
| Right | 983677643 | 4:170314737-170314759 | TTGCTGTATAATTTGGAATCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 983677640 | Original CRISPR | AAACTCAGCTTCACAAAGAT AGG (reversed) | Intergenic | ||