ID: 983689257

View in Genome Browser
Species Human (GRCh38)
Location 4:170448293-170448315
Sequence CACAGAGAAATGGCTACGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983689257_983689259 -8 Left 983689257 4:170448293-170448315 CCTCACGTAGCCATTTCTCTGTG No data
Right 983689259 4:170448308-170448330 TCTCTGTGTGTGTGTGCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983689257 Original CRISPR CACAGAGAAATGGCTACGTG AGG (reversed) Intergenic
No off target data available for this crispr