ID: 983699666

View in Genome Browser
Species Human (GRCh38)
Location 4:170576818-170576840
Sequence AGTGACAGGATTCCAAAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983699666_983699670 -6 Left 983699666 4:170576818-170576840 CCCTCCTTTGGAATCCTGTCACT No data
Right 983699670 4:170576835-170576857 GTCACTGACTATTATATATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983699666 Original CRISPR AGTGACAGGATTCCAAAGGA GGG (reversed) Intergenic
No off target data available for this crispr