ID: 983702422

View in Genome Browser
Species Human (GRCh38)
Location 4:170614482-170614504
Sequence CAGGGCTTCCTGAAGCTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983702422_983702428 -4 Left 983702422 4:170614482-170614504 CCACAAAGCTTCAGGAAGCCCTG No data
Right 983702428 4:170614501-170614523 CCTGCCCTCAAGGCTTTGGTGGG No data
983702422_983702432 23 Left 983702422 4:170614482-170614504 CCACAAAGCTTCAGGAAGCCCTG No data
Right 983702432 4:170614528-170614550 TTTCATGCATCAGCTCTCATGGG No data
983702422_983702424 -8 Left 983702422 4:170614482-170614504 CCACAAAGCTTCAGGAAGCCCTG No data
Right 983702424 4:170614497-170614519 AAGCCCTGCCCTCAAGGCTTTGG No data
983702422_983702431 22 Left 983702422 4:170614482-170614504 CCACAAAGCTTCAGGAAGCCCTG No data
Right 983702431 4:170614527-170614549 ATTTCATGCATCAGCTCTCATGG No data
983702422_983702433 27 Left 983702422 4:170614482-170614504 CCACAAAGCTTCAGGAAGCCCTG No data
Right 983702433 4:170614532-170614554 ATGCATCAGCTCTCATGGGTTGG No data
983702422_983702426 -5 Left 983702422 4:170614482-170614504 CCACAAAGCTTCAGGAAGCCCTG No data
Right 983702426 4:170614500-170614522 CCCTGCCCTCAAGGCTTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983702422 Original CRISPR CAGGGCTTCCTGAAGCTTTG TGG (reversed) Intergenic
No off target data available for this crispr