ID: 983702444

View in Genome Browser
Species Human (GRCh38)
Location 4:170614635-170614657
Sequence CAATGCCTAGTGGAGTCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983702444_983702454 30 Left 983702444 4:170614635-170614657 CCCTGTGACTCCACTAGGCATTG No data
Right 983702454 4:170614688-170614710 CCCTGTGCAGATTTCTTCCTGGG No data
983702444_983702448 -1 Left 983702444 4:170614635-170614657 CCCTGTGACTCCACTAGGCATTG No data
Right 983702448 4:170614657-170614679 GCCCTAATGGAGATTCTCTTAGG No data
983702444_983702452 29 Left 983702444 4:170614635-170614657 CCCTGTGACTCCACTAGGCATTG No data
Right 983702452 4:170614687-170614709 CCCCTGTGCAGATTTCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983702444 Original CRISPR CAATGCCTAGTGGAGTCACA GGG (reversed) Intergenic
No off target data available for this crispr