ID: 983702447

View in Genome Browser
Species Human (GRCh38)
Location 4:170614645-170614667
Sequence TCCATTAGGGCAATGCCTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983702447_983702452 19 Left 983702447 4:170614645-170614667 CCACTAGGCATTGCCCTAATGGA No data
Right 983702452 4:170614687-170614709 CCCCTGTGCAGATTTCTTCCTGG No data
983702447_983702454 20 Left 983702447 4:170614645-170614667 CCACTAGGCATTGCCCTAATGGA No data
Right 983702454 4:170614688-170614710 CCCTGTGCAGATTTCTTCCTGGG No data
983702447_983702456 28 Left 983702447 4:170614645-170614667 CCACTAGGCATTGCCCTAATGGA No data
Right 983702456 4:170614696-170614718 AGATTTCTTCCTGGGCTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983702447 Original CRISPR TCCATTAGGGCAATGCCTAG TGG (reversed) Intergenic
No off target data available for this crispr