ID: 983702449

View in Genome Browser
Species Human (GRCh38)
Location 4:170614658-170614680
Sequence ACCTAAGAGAATCTCCATTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983702449_983702456 15 Left 983702449 4:170614658-170614680 CCCTAATGGAGATTCTCTTAGGT No data
Right 983702456 4:170614696-170614718 AGATTTCTTCCTGGGCTCTCAGG No data
983702449_983702452 6 Left 983702449 4:170614658-170614680 CCCTAATGGAGATTCTCTTAGGT No data
Right 983702452 4:170614687-170614709 CCCCTGTGCAGATTTCTTCCTGG No data
983702449_983702454 7 Left 983702449 4:170614658-170614680 CCCTAATGGAGATTCTCTTAGGT No data
Right 983702454 4:170614688-170614710 CCCTGTGCAGATTTCTTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983702449 Original CRISPR ACCTAAGAGAATCTCCATTA GGG (reversed) Intergenic
No off target data available for this crispr