ID: 983702452

View in Genome Browser
Species Human (GRCh38)
Location 4:170614687-170614709
Sequence CCCCTGTGCAGATTTCTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983702450_983702452 5 Left 983702450 4:170614659-170614681 CCTAATGGAGATTCTCTTAGGTA No data
Right 983702452 4:170614687-170614709 CCCCTGTGCAGATTTCTTCCTGG No data
983702443_983702452 30 Left 983702443 4:170614634-170614656 CCCCTGTGACTCCACTAGGCATT No data
Right 983702452 4:170614687-170614709 CCCCTGTGCAGATTTCTTCCTGG No data
983702449_983702452 6 Left 983702449 4:170614658-170614680 CCCTAATGGAGATTCTCTTAGGT No data
Right 983702452 4:170614687-170614709 CCCCTGTGCAGATTTCTTCCTGG No data
983702444_983702452 29 Left 983702444 4:170614635-170614657 CCCTGTGACTCCACTAGGCATTG No data
Right 983702452 4:170614687-170614709 CCCCTGTGCAGATTTCTTCCTGG No data
983702445_983702452 28 Left 983702445 4:170614636-170614658 CCTGTGACTCCACTAGGCATTGC No data
Right 983702452 4:170614687-170614709 CCCCTGTGCAGATTTCTTCCTGG No data
983702447_983702452 19 Left 983702447 4:170614645-170614667 CCACTAGGCATTGCCCTAATGGA No data
Right 983702452 4:170614687-170614709 CCCCTGTGCAGATTTCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983702452 Original CRISPR CCCCTGTGCAGATTTCTTCC TGG Intergenic
No off target data available for this crispr