ID: 983702454

View in Genome Browser
Species Human (GRCh38)
Location 4:170614688-170614710
Sequence CCCTGTGCAGATTTCTTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983702449_983702454 7 Left 983702449 4:170614658-170614680 CCCTAATGGAGATTCTCTTAGGT No data
Right 983702454 4:170614688-170614710 CCCTGTGCAGATTTCTTCCTGGG No data
983702445_983702454 29 Left 983702445 4:170614636-170614658 CCTGTGACTCCACTAGGCATTGC No data
Right 983702454 4:170614688-170614710 CCCTGTGCAGATTTCTTCCTGGG No data
983702447_983702454 20 Left 983702447 4:170614645-170614667 CCACTAGGCATTGCCCTAATGGA No data
Right 983702454 4:170614688-170614710 CCCTGTGCAGATTTCTTCCTGGG No data
983702444_983702454 30 Left 983702444 4:170614635-170614657 CCCTGTGACTCCACTAGGCATTG No data
Right 983702454 4:170614688-170614710 CCCTGTGCAGATTTCTTCCTGGG No data
983702450_983702454 6 Left 983702450 4:170614659-170614681 CCTAATGGAGATTCTCTTAGGTA No data
Right 983702454 4:170614688-170614710 CCCTGTGCAGATTTCTTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983702454 Original CRISPR CCCTGTGCAGATTTCTTCCT GGG Intergenic
No off target data available for this crispr