ID: 983702456

View in Genome Browser
Species Human (GRCh38)
Location 4:170614696-170614718
Sequence AGATTTCTTCCTGGGCTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983702450_983702456 14 Left 983702450 4:170614659-170614681 CCTAATGGAGATTCTCTTAGGTA No data
Right 983702456 4:170614696-170614718 AGATTTCTTCCTGGGCTCTCAGG No data
983702449_983702456 15 Left 983702449 4:170614658-170614680 CCCTAATGGAGATTCTCTTAGGT No data
Right 983702456 4:170614696-170614718 AGATTTCTTCCTGGGCTCTCAGG No data
983702447_983702456 28 Left 983702447 4:170614645-170614667 CCACTAGGCATTGCCCTAATGGA No data
Right 983702456 4:170614696-170614718 AGATTTCTTCCTGGGCTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983702456 Original CRISPR AGATTTCTTCCTGGGCTCTC AGG Intergenic
No off target data available for this crispr