ID: 983708556

View in Genome Browser
Species Human (GRCh38)
Location 4:170687631-170687653
Sequence CAAGGTCCAAACGTCCTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983708554_983708556 -4 Left 983708554 4:170687612-170687634 CCAGCAGCACAATGCTAGGCAAG No data
Right 983708556 4:170687631-170687653 CAAGGTCCAAACGTCCTGCCTGG No data
983708552_983708556 0 Left 983708552 4:170687608-170687630 CCTGCCAGCAGCACAATGCTAGG No data
Right 983708556 4:170687631-170687653 CAAGGTCCAAACGTCCTGCCTGG No data
983708551_983708556 27 Left 983708551 4:170687581-170687603 CCAAAATGGTGGTGCAGCAGTGT No data
Right 983708556 4:170687631-170687653 CAAGGTCCAAACGTCCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983708556 Original CRISPR CAAGGTCCAAACGTCCTGCC TGG Intergenic
No off target data available for this crispr