ID: 983722914

View in Genome Browser
Species Human (GRCh38)
Location 4:170880233-170880255
Sequence ATTCACTCCAGTCATTATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983722912_983722914 3 Left 983722912 4:170880207-170880229 CCTGAAATTTTCAGGGTTACCTA No data
Right 983722914 4:170880233-170880255 ATTCACTCCAGTCATTATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983722914 Original CRISPR ATTCACTCCAGTCATTATGT AGG Intergenic
No off target data available for this crispr