ID: 983724624

View in Genome Browser
Species Human (GRCh38)
Location 4:170905335-170905357
Sequence TAATAACCTTTCAGTACTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983724624_983724626 23 Left 983724624 4:170905335-170905357 CCTTCAGTACTGAAAGGTTATTA No data
Right 983724626 4:170905381-170905403 CAATAATTAACAAAGTGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983724624 Original CRISPR TAATAACCTTTCAGTACTGA AGG (reversed) Intergenic
No off target data available for this crispr